Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13119
Trapped Gene
Inhbc (ENSMUSG00000025405)
Vector Insertion
Chr 10: 126794886 - 126807136
Public Clones CMHD-GT_505F3-3 (cmhd) CMHD-GT_328C1-3 (cmhd) CMHD-GT_326A1-3 (cmhd) CMHD-GT_543E6-5S (cmhd)
PST10836-NL (escells) IST12984D10 (tigm) IST14814B3 (tigm) IST11373F4 (tigm)
IST14401F2 (tigm) IST14126F4 (tigm) IST14595G4 (tigm) IST13760F10 (tigm)
IST10906D9 (tigm) IST14039C10 (tigm) IST13041E12 (tigm) IST14698G7 (tigm)
IST13805E7 (tigm) IST11169A2 (tigm) IST14666H12 (tigm) IST12984D10 (tigm)
IST13805E7 (tigm) IST14789B9 (tigm) IST13589B11 (tigm) IST14381B4 (tigm)
IST14586C4 (tigm) IST13859F7 (tigm) IST13608G6 (tigm) IST12926F8 (tigm)
IST14642G10 (tigm) IST12143H4 (tigm) IST14626G11 (tigm) IST14444G11 (tigm)
IST13039E12 (tigm) IST13157F3 (tigm) IST14698G7 (tigm) IST11490H7 (tigm)
IST14830E9 (tigm) IST13961E12 (tigm) IST13194F12 (tigm) IST14856B6 (tigm)
IST12260H5 (tigm) IST12435A3 (tigm) IST13178A7 (tigm) IST13390F8 (tigm)
IST14799G1 (tigm) IST13381A10 (tigm) IST14479B6 (tigm) IST11538C7BBF1 (tigm)
IST14479B6 (tigm) IST13624G9 (tigm) IST12719B1 (tigm) IST14441G6 (tigm)
IST13433B9 (tigm)
Private Clones OST411906 (lexicon) OST389544 (lexicon) OST356742 (lexicon) OST352391 (lexicon)
OST283240 (lexicon) OST268685 (lexicon) OST262453 (lexicon) OST176159 (lexicon)
OST176123 (lexicon) OST159376 (lexicon) OST157199 (lexicon) OST146638 (lexicon)
OST145009 (lexicon) OST144997 (lexicon) OST123475 (lexicon) OST117869 (lexicon)
OST115673 (lexicon) OST114462 (lexicon) OST105437 (lexicon) OST76069 (lexicon)
OST57188 (lexicon)
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000150541 (Chr10:126807137..126807487 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCATCTTTGACCTGGAGAGC Chr10:126807339..126807358 59.8 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000150541 (Chr10:126807137..126807487 -)
Downstram Exon
ENSMUSE00000425444 (Chr10:126793384..126794885 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCATCTTTGACCTGGAGAGC Chr10:126807339..126807358 59.8 55 GTGGGGGAACTGTACGAAGA Chr10:126794754..126794773 59.97 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000150541 Chr10:126807137..126807487 CCATCTTTGACCTGGAGAGC Chr10:126807339..126807358 59.8 55

*** Putative Vector Insertion (Chr 10: 126794886 - 126807136) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000425444 Chr10:126793384..126794885 GTGGGGGAACTGTACGAAGA Chr10:126794754..126794773 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAGCTTTGCTGACACAGGT Chr10:126807133..126807153 59.62 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTACCGTGACTGGGAAAACC Chr10:126807069..126807090 60.27 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCCCGTTGAGACCCTGAATA Chr10:126795488..126795508 60.45 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCCTTCGTGACTGGGAAAAC Chr10:126795422..126795442 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025405