Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1312
Trapped Gene
Ubl3 (ENSMUSG00000001687)
Vector Insertion
Chr 5: 149318100 - 149320844
Public Clones DC0123 (sanger) CSH870 (baygenomics) D131F04 (ggtc) E132F04 (ggtc)
CMHD-GT_486D7-3 (cmhd)
Private Clones OST455414 (lexicon) OST324906 (lexicon) OST321772 (lexicon) OST272423 (lexicon)
OST127223 (lexicon) OST66229 (lexicon) OST55854 (lexicon) OST46079 (lexicon)
OST43113 (lexicon)
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000191057 (Chr5:149320845..149320931 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000191057 (Chr5:149320845..149320931 -)
Downstram Exon
ENSMUSE00000191055 (Chr5:149318022..149318099 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684215 Chr5:149363529..149364041 No primer for this exon
upstream ENSMUSE00000404861 Chr5:149323470..149323578 No primer for this exon
upstream ENSMUSE00000191057 Chr5:149320845..149320931 No primer for this exon

*** Putative Vector Insertion (Chr 5: 149318100 - 149320844) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000191055 Chr5:149318022..149318099 No primer for this exon
downstream ENSMUSE00000647629 Chr5:149316239..149317763 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATGACATAATCGCCTTGCAG Chr5:149320779..149320800 60.11 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACACGTGACTGGGAAAACC Chr5:149320777..149320797 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTGGGAAGAAGAGCAGGTCA Chr5:149320909..149320929 60.52 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTGGGAAGAAGAGCAGGTCA Chr5:149320909..149320929 60.52 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001687