Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13126
Trapped Gene
Cisd1 (ENSMUSG00000037710)
Vector Insertion
Chr 10: 70799168 - 70807471
Public Clones CMHD-GT_476B9-3 (cmhd) CMHD-GT_453E3-3 (cmhd) (cmhd) CMHD-GT_476B8-3 (cmhd)
CMHD-GT_324G10-3 (cmhd)
Private Clones OST466362 (lexicon) OST267232 (lexicon) OST261423 (lexicon) OST248145 (lexicon)
OST247274 (lexicon) OST205742 (lexicon) OST201677 (lexicon) OST183774 (lexicon)
OST178751 (lexicon) OST133841 (lexicon) OST125546 (lexicon) OST69676 (lexicon)
OST59997 (lexicon) OST43998 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000406752 (Chr10:70807472..70807601 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCAGCTCCAACTCCGCTGT Chr10:70807477..70807496 63.04 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000406752 (Chr10:70807472..70807601 -)
Downstram Exon
ENSMUSE00000287033 (Chr10:70798962..70799167 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCAGCTCCAACTCCGCTGT Chr10:70807477..70807496 63.04 60 GCTTTGGTGCGATTCTCTTT Chr10:70799049..70799068 59.46 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000406752 Chr10:70807472..70807601 CTCAGCTCCAACTCCGCTGT Chr10:70807477..70807496 63.04 60

*** Putative Vector Insertion (Chr 10: 70799168 - 70807471) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000287033 Chr10:70798962..70799167 GCTTTGGTGCGATTCTCTTT Chr10:70799049..70799068 59.46 45
downstream ENSMUSE00000342068 Chr10:70793471..70793874 CCCATATAGCACGAGGTTGG Chr10:70793542..70793561 60.34 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCTTACCCTCCCATTTCCA Chr10:70801460..70801480 58.98 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACCTTCGTGACTGGGAAAA Chr10:70801406..70801426 61.06 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTCTAATCGCCTTGCAGCAC Chr10:70801534..70801554 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTCCTGGGAAGTAGCCTTCA Chr10:70804570..70804590 59.81 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037710