Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13131
Trapped Gene
Esam (ENSMUSG00000001946)
Vector Insertion
Chr 9: 37335876 - 37339072
Public Clones CMHD-GT_337B5-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000330708 (Chr9:37335698..37335875 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000330708 (Chr9:37335698..37335875 +)
Downstram Exon
ENSMUSE00000216868 (Chr9:37339073..37339260 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000330708 Chr9:37335698..37335875 No primer for this exon

*** Putative Vector Insertion (Chr 9: 37335876 - 37339072) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000216868 Chr9:37339073..37339260 No primer for this exon
downstream ENSMUSE00000216860 Chr9:37341738..37341939 No primer for this exon
downstream ENSMUSE00000354605 Chr9:37342123..37342278 No primer for this exon
downstream ENSMUSE00000397851 Chr9:37344183..37344305 No primer for this exon
downstream ENSMUSE00000216857 Chr9:37344591..37344717 No primer for this exon
downstream ENSMUSE00000407528 Chr9:37345049..37345891 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACGTCGGAGTGAGGAGAAG Chr9:37338901..37338921 59.99 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACGTCGGAGTGAGGAGAAG Chr9:37338901..37338921 59.99 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001946