Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13139
Trapped Gene
Brsk1 (ENSMUSG00000035390)
Vector Insertion
Chr 7: 4644568 - 4646275
Public Clones CMHD-GT_327A5-3 (cmhd)
Private Clones OST287242 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000538496 (Chr7:4644482..4644567 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCACGACGTCTACGAGAACA Chr7:4644538..4644557 59.9 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000538496 (Chr7:4644482..4644567 +)
Downstram Exon
ENSMUSE00000538495 (Chr7:4646276..4646416 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCACGACGTCTACGAGAACA Chr7:4644538..4644557 59.9 55 CACCAGAAACGTGCTCAAGA Chr7:4646307..4646326 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000720072 Chr7:4642206..4642322 CCGGAGAGAAAGGACGAGGT Chr7:4642257..4642276 62.96 60
upstream ENSMUSE00000368497 Chr7:4642530..4642817 No primer for this exon
upstream ENSMUSE00000720032 Chr7:4642760..4642817 No primer for this exon
upstream ENSMUSE00000538497 Chr7:4644256..4644350 TCAGAAGGTCGCTGTCAAGA Chr7:4644290..4644309 59.7 50
upstream ENSMUSE00000715727 Chr7:4644256..4644350 TCAGAAGGTCGCTGTCAAGA Chr7:4644290..4644309 59.7 50
upstream ENSMUSE00000538496 Chr7:4644482..4644567 CCACGACGTCTACGAGAACA Chr7:4644538..4644557 59.9 55

*** Putative Vector Insertion (Chr 7: 4644568 - 4646275) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000538495 Chr7:4646276..4646416 CACCAGAAACGTGCTCAAGA Chr7:4646307..4646326 60.03 50
downstream ENSMUSE00000538494 Chr7:4650302..4650418 GGACGCCATACCAAAGTCTG Chr7:4650383..4650402 60.52 55
downstream ENSMUSE00000538492 Chr7:4650521..4650554 TCACCTCTGGACATGCGTAA Chr7:4650552..4650571 60.26 50
downstream ENSMUSE00000538491 Chr7:4650640..4650708 CAAGCAGGGCAAATAGGATG Chr7:4650709..4650728 60.6 50
downstream ENSMUSE00000303425 Chr7:4655730..4655876 AGGGATGAAGTGAGGCATGT Chr7:4655819..4655838 59.53 50
downstream ENSMUSE00000303419 Chr7:4656286..4656317 No primer for this exon
downstream ENSMUSE00000303416 Chr7:4656670..4656840 CAGGCTACGCATGGCTACTC Chr7:4656742..4656761 60.96 60
downstream ENSMUSE00000303412 Chr7:4657622..4657719 CTTTCCGATCCAAAAGCAAA Chr7:4657671..4657690 60.18 40
downstream ENSMUSE00000303404 Chr7:4657937..4658096 AATCCACACGCTTACGAGGT Chr7:4657963..4657982 59.62 50
downstream ENSMUSE00000514528 Chr7:4658264..4658324 CTGGAGGACAGACCAGTGGA Chr7:4658308..4658327 61.29 60
downstream ENSMUSE00000515644 Chr7:4658718..4659087 AGTTGAGCCGACTTCTCCAG Chr7:4659036..4659055 59.6 55
downstream ENSMUSE00000303393 Chr7:4659500..4659548 GGATTCTGGTGTCAAACTGGA Chr7:4659542..4659562 59.96 47.62
downstream ENSMUSE00000303384 Chr7:4659651..4659774 GAGATGAAATTCCCGAACCA Chr7:4659689..4659708 59.87 45
downstream ENSMUSE00000303375 Chr7:4660420..4660618 GACCCTCAGAGGAGCTGATG Chr7:4660549..4660568 59.94 60
downstream ENSMUSE00000538485 Chr7:4662024..4662113 TGGATGGTCTCTACCACACG Chr7:4662066..4662085 59.54 55
downstream ENSMUSE00000507234 Chr7:4666935..4667598 GGTAGAGGGGTTCCATTGGT Chr7:4667091..4667110 60.05 55
downstream ENSMUSE00000714192 Chr7:4666935..4667583 GGTAGAGGGGTTCCATTGGT Chr7:4667091..4667110 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr7:4644617..4644637 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTGTACGTGACTGGGAAA Chr7:4644612..4644632 60 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035390