Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13150
Trapped Gene
D17Wsu92e (ENSMUSG00000056692)
Vector Insertion
Chr 17: 27931009 - 27957121
Public Clones (sanger) (sanger) CMHD-GT_325H5-3 (cmhd) FHCRC-GT-S13-6D1 (fhcrc) IST14430F4 (tigm)
IST11536H4 (tigm) IST14874C10 (tigm) IST14894F5 (tigm) IST14102A2 (tigm)
IST14905B8 (tigm) IST14079H12 (tigm) IST14824G12 (tigm) IST13150B2 (tigm)
IST14843C11 (tigm) IST12496B6 (tigm) IST13612B3 (tigm) IST12838E8 (tigm)
IST14291A8 (tigm) IST15057F6 (tigm) IST14432F1 (tigm) IST11904A12 (tigm)
IST11129D10 (tigm) IST14291A8 (tigm) IST14822E10 (tigm) IST14079H12 (tigm)
IST14843C11 (tigm) IST12111E5 (tigm) IST14615A5 (tigm) IST14854A4 (tigm)
IST12496B6 (tigm) IST15015H2 (tigm) IST11495B5 (tigm) IST11804E10 (tigm)
IST14897B9 (tigm) IST11129D10 (tigm)
Private Clones OST442309 (lexicon) OST433090 (lexicon) OST432964 (lexicon) OST432792 (lexicon)
OST427508 (lexicon) OST420540 (lexicon) OST401521 (lexicon) OST379733 (lexicon)
OST371323 (lexicon) OST320412 (lexicon) OST232188 (lexicon) OST198754 (lexicon)
OST198396 (lexicon) OST176498 (lexicon) OST148089 (lexicon) OST129851 (lexicon)
OST111579 (lexicon) OST101544 (lexicon) OST46454 (lexicon) OST40165 (lexicon)
OST37543 (lexicon) OST34383 (lexicon) OST34223 (lexicon)
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000700826 (Chr17:27957122..27957436 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACGTGCTCATCTCCGAGTTC Chr17:27957187..27957206 60.42 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000700826 (Chr17:27957122..27957436 -)
Downstram Exon
ENSMUSE00000449145 (Chr17:27930854..27931008 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACGTGCTCATCTCCGAGTTC Chr17:27957187..27957206 60.42 55 GCCAATCGCTGCTTGTAAGT Chr17:27930965..27930984 60.42 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000610260 Chr17:27957122..27957487 ACGTGCTCATCTCCGAGTTC Chr17:27957187..27957206 60.42 55
upstream ENSMUSE00000700826 Chr17:27957122..27957436 ACGTGCTCATCTCCGAGTTC Chr17:27957187..27957206 60.42 55
upstream ENSMUSE00000713263 Chr17:27957122..27957487 ACGTGCTCATCTCCGAGTTC Chr17:27957187..27957206 60.42 55

*** Putative Vector Insertion (Chr 17: 27931009 - 27957121) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000449145 Chr17:27930854..27931008 GCCAATCGCTGCTTGTAAGT Chr17:27930965..27930984 60.42 50
downstream ENSMUSE00000449130 Chr17:27923016..27923213 CTGACGTCTGCGATCTCTTG Chr17:27923077..27923096 59.73 55
downstream ENSMUSE00000700825 Chr17:27905081..27905184 ACAGCTGCTGCGTTACTCCT Chr17:27905100..27905119 60.22 55
downstream ENSMUSE00000449140 Chr17:27904856..27905184 ACAGCTGCTGCGTTACTCCT Chr17:27905100..27905119 60.22 55
downstream ENSMUSE00000700820 Chr17:27904434..27905184 GGCAGTGGTGGTCTAGCATT Chr17:27904744..27904763 60.14 55
downstream ENSMUSE00000700822 Chr17:27888191..27890940 TCCTGCAGTTCAGCATTCAC Chr17:27890678..27890697 59.99 50
downstream ENSMUSE00000700827 Chr17:27888181..27890940 TCCTGCAGTTCAGCATTCAC Chr17:27890678..27890697 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGCAGGCTTGTTTCTTTTCT Chr17:27951081..27951101 59.63 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTACGTGACTGGGAAAAC Chr17:27951055..27951075 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CAGCACCCAAAGGAGAAGAA Chr17:27951424..27951444 60.37 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGCACCCAAAGGAGAAGAA Chr17:27951424..27951444 60.37 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056692