Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13165
Trapped Gene
Slc7a7 (ENSMUSG00000000958)
Vector Insertion
Chr 14: 54998910 - 55027339
Public Clones (sanger) D179G12 (ggtc) D179G12 (ggtc) CMHD-GT_324C9-3 (cmhd) IST11913E1 (tigm)
IST12755B9 (tigm) IST12414E7 (tigm) IST11084C4 (tigm) IST10208B4 (tigm)
IST14132B10 (tigm) IST12034F5HMF1 (tigm) IST10197C10 (tigm) IST10197C10 (tigm)
IST14537H12 (tigm) IST10806G4 (tigm) IST11561F12 (tigm) IST10548B3 (tigm)
IST10548B3 (tigm) IST12488A4 (tigm) IST12853A12 (tigm) IST10806G4 (tigm)
IST10992H9 (tigm) IST10992H9 (tigm) IST11846G8 (tigm) IST11137G12 (tigm)
IST12359C5 (tigm) IST12359C5 (tigm) IST14769A3 (tigm)
Private Clones OST424200 (lexicon) OST290392 (lexicon) OST40088 (lexicon)
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000124136 (Chr14:55027340..55027885 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000124136 (Chr14:55027340..55027885 -)
Downstram Exon
ENSMUSE00000124133 (Chr14:54998784..54998909 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000323914 Chr14:55028087..55028297 No primer for this exon
upstream ENSMUSE00000124136 Chr14:55027340..55027885 No primer for this exon

*** Putative Vector Insertion (Chr 14: 54998910 - 55027339) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000124133 Chr14:54998784..54998909 No primer for this exon
downstream ENSMUSE00000124135 Chr14:54997450..54997594 No primer for this exon
downstream ENSMUSE00000559616 Chr14:54994232..54994355 No primer for this exon
downstream ENSMUSE00000124130 Chr14:54993898..54994001 No primer for this exon
downstream ENSMUSE00000124131 Chr14:54993526..54993622 No primer for this exon
downstream ENSMUSE00000124128 Chr14:54992624..54992773 No primer for this exon
downstream ENSMUSE00000124132 Chr14:54989777..54989960 No primer for this exon
downstream ENSMUSE00000388042 Chr14:54989128..54989570 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr14:55027269..55027289 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAGGAGGGGTGGACACTCA Chr14:55027291..55027311 60.1 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGATCAGAGCAGGCTAAAGGT Chr14:55027910..55027931 59.09 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTGGAGTTCGGTCATTTTCC Chr14:55015886..55015906 59.53 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000958