Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13193
Trapped Gene
A130092J06Rik (ENSMUSG00000050592)
Vector Insertion
Chr 2: 31925294 - 31938103
Public Clones CMHD-GT_323E6-3 (cmhd) CMHD-GT_422C8-3 (cmhd) CMHD-GT_282B07-3 (cmhd) CMHD-GT_438H7-3 (cmhd)
IST14398A9 (tigm) IST12656F1 (tigm) IST14807F7 (tigm) IST12656F1 (tigm)
IST12339G12 (tigm) IST14807F7 (tigm)
Private Clones OST459072 (lexicon) OST346710 (lexicon) OST340874 (lexicon) OST316313 (lexicon)
OST313390 (lexicon) OST135013 (lexicon) OST108162 (lexicon)
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000376112 (Chr2:31938104..31939227 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGAAGGGATTACCGTGATT Chr2:31938304..31938323 60.02 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000376112 (Chr2:31938104..31939227 -)
Downstram Exon
ENSMUSE00000333044 (Chr2:31922409..31925293 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGAAGGGATTACCGTGATT Chr2:31938304..31938323 60.02 50 GTGCAGGTCTCCGTGGTATT Chr2:31925167..31925186 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000376112 Chr2:31938104..31939227 GGGAAGGGATTACCGTGATT Chr2:31938304..31938323 60.02 50

*** Putative Vector Insertion (Chr 2: 31925294 - 31938103) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000333044 Chr2:31922409..31925293 GTGCAGGTCTCCGTGGTATT Chr2:31925167..31925186 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGAGTACTCCTGGGGACA Chr2:31926083..31926103 59.1 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGAGTACTCCTGGGGACA Chr2:31926083..31926103 59.1 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CAGTCAGAGCTGGGAAGAGG Chr2:31924250..31924270 60.13 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGTCAGAGCTGGGAAGAGG Chr2:31924250..31924270 60.13 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050592