Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13194
Trapped Gene
Krtcap2 (ENSMUSG00000042747)
Vector Insertion
Chr 3: 89051051 - 89052995
Public Clones CMHD-GT_325B6-3 (cmhd) CMHD-GT_434B6-3 (cmhd) CMHD-GT_506G6-3 (cmhd)
Private Clones OST452636 (lexicon) OST436068 (lexicon) OST425873 (lexicon) OST336000 (lexicon)
OST329292 (lexicon) OST310440 (lexicon) OST292850 (lexicon) OST276334 (lexicon)
OST258760 (lexicon) OST189512 (lexicon) OST139510 (lexicon) OST139505 (lexicon)
OST127173 (lexicon) OST28221 (lexicon) OST24728 (lexicon) OST23211 (lexicon)
OST13722 (lexicon) OST7604 (lexicon) OST7054 (lexicon) OST6957 (lexicon)
OST5618 (lexicon) OST5356 (lexicon) OST531 (lexicon)
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000310335 (Chr3:89050987..89051050 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGTAAAGGCTTCCAAGCAA Chr3:89051016..89051035 60.74 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000310335 (Chr3:89050987..89051050 +)
Downstram Exon
ENSMUSE00000310326 (Chr3:89052996..89053062 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGTAAAGGCTTCCAAGCAA Chr3:89051016..89051035 60.74 45 GACACAAACTCGGTGGATGA Chr3:89053057..89053076 59.53 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000376450 Chr3:89050182..89050437 GGCGCGTAGAGGAAGAAGTA Chr3:89050312..89050331 59.62 55
upstream ENSMUSE00000310340 Chr3:89050700..89050854 CCTTTTCGTCTTCTCCCTGA Chr3:89050833..89050852 59.4 50
upstream ENSMUSE00000310335 Chr3:89050987..89051050 TGGTAAAGGCTTCCAAGCAA Chr3:89051016..89051035 60.74 45

*** Putative Vector Insertion (Chr 3: 89051051 - 89052995) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000310326 Chr3:89052996..89053062 GACACAAACTCGGTGGATGA Chr3:89053057..89053076 59.53 50
downstream ENSMUSE00000380177 Chr3:89053493..89053644 TGTTGCCTGGTACAGAGTGG Chr3:89053562..89053581 59.74 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTAAAGGCTTCCAAGCAAA Chr3:89051018..89051038 59.34 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTAAAGGCTTCCAAGCAAA Chr3:89051018..89051038 59.34 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042747