Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13202
Trapped Gene
Clic4 (ENSMUSG00000037242)
Vector Insertion
Chr 4: 134779486 - 134781938
Public Clones CMHD-GT_341C8-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000264643 (Chr4:134781939..134782064 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCGAAGTCAAGACGGATGT Chr4:134781984..134782003 59.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000264643 (Chr4:134781939..134782064 -)
Downstram Exon
ENSMUSE00000264631 (Chr4:134779379..134779485 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCGAAGTCAAGACGGATGT Chr4:134781984..134782003 59.87 50 AGTGTTCGACTCTGGGTGCT Chr4:134779424..134779443 59.91 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000264663 Chr4:134828433..134828678 TCATCGAGCTCTTCGTCAAG Chr4:134828433..134828452 59.27 50
upstream ENSMUSE00000524581 Chr4:134794777..134794886 GTGTCACAACCGTTGACCTG Chr4:134794782..134794801 60.05 55
upstream ENSMUSE00000264643 Chr4:134781939..134782064 AGCGAAGTCAAGACGGATGT Chr4:134781984..134782003 59.87 50

*** Putative Vector Insertion (Chr 4: 134779486 - 134781938) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000264631 Chr4:134779379..134779485 AGTGTTCGACTCTGGGTGCT Chr4:134779424..134779443 59.91 55
downstream ENSMUSE00000496847 Chr4:134774423..134774604 GAAACCGACGTGTGGAAAAT Chr4:134774463..134774482 59.84 45
downstream ENSMUSE00000497876 Chr4:134772898..134773180 GAGGCGGAGCAGTCTGTTAG Chr4:134772925..134772944 60.16 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGCCCACCCAAGTGAGTAT Chr4:134781929..134781949 59.85 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGCCCACCCAAGTGAGTAT Chr4:134781929..134781949 59.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037242