Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1321
Trapped Gene
Csnk2a1 (ENSMUSG00000074698)
Vector Insertion
Chr 2: 152052728 - 152076137
Public Clones (sanger) DC0087 (sanger) (sanger) (sanger) (sanger) RRR512 (baygenomics)
RRU528 (baygenomics) E112F05 (ggtc) D033E11 (ggtc) D017G12 (ggtc)
(ggtc) P067E10 (ggtc) P146G04 (ggtc) D138E02 (ggtc) D024C11 (ggtc)
W239D03 (ggtc) P104G11 (ggtc) D034A04 (ggtc) D019D01 (ggtc) P028C08 (ggtc)
E112F05 (ggtc) D025A04 (ggtc) D015A02 (ggtc) (ggtc) P065F12 (ggtc)
P145F04 (ggtc) D039B08 (ggtc) D020E07 (ggtc) M051A02 (ggtc) H006B04 (ggtc)
D033E11 (ggtc) D019D01 (ggtc) P082E06 (ggtc) D138E02 (ggtc) D024C11 (ggtc)
D015A02 (ggtc) P063E10 (ggtc) P145F04 (ggtc) D039B08 (ggtc) D020E07 (ggtc)
5SE311C04 (ggtc) PST9988-NR (escells) PST18161-NR (escells) PST6275-NL (escells)
PST17495-NR (escells) PST1398-NL (escells) IST14568F6 (tigm) IST14467F4 (tigm)
Private Clones OST404756 (lexicon) OST37556 (lexicon) OST35840 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681813 (Chr2:152052618..152052727 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGCCATATTGTCTGTGTGA Chr2:152052665..152052684 60.54 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681813 (Chr2:152052618..152052727 +)
Downstram Exon
ENSMUSE00000640046 (Chr2:152076138..152076347 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGCCATATTGTCTGTGTGA Chr2:152052665..152052684 60.54 50 TGTTCAAAAGCAGACGTTGG Chr2:152076192..152076211 59.88 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681813 Chr2:152052618..152052727 CCGCCATATTGTCTGTGTGA Chr2:152052665..152052684 60.54 50
upstream ENSMUSE00000640047 Chr2:152052621..152052727 CCGCCATATTGTCTGTGTGA Chr2:152052665..152052684 60.54 50

*** Putative Vector Insertion (Chr 2: 152052728 - 152076137) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000640046 Chr2:152076138..152076347 TGTTCAAAAGCAGACGTTGG Chr2:152076192..152076211 59.88 45
downstream ENSMUSE00000640045 Chr2:152079946..152080057 TTGCCCCTACCTAATTTTCG Chr2:152079993..152080012 59.08 45
downstream ENSMUSE00000640044 Chr2:152083114..152083215 GGCCCACCTCTCAAATTCTC Chr2:152083178..152083197 60.97 55
downstream ENSMUSE00000640043 Chr2:152083677..152083727 No primer for this exon
downstream ENSMUSE00000640042 Chr2:152084412..152084471 No primer for this exon
downstream ENSMUSE00000711309 Chr2:152086495..152086578 TAATCCCCATGCTGTGACAA Chr2:152086528..152086547 59.92 45
downstream ENSMUSE00000712610 Chr2:152086495..152086578 TAATCCCCATGCTGTGACAA Chr2:152086528..152086547 59.92 45
downstream ENSMUSE00000640040 Chr2:152088919..152089029 TGGCCTGGATGGTAAAACTC Chr2:152088968..152088987 59.93 50
downstream ENSMUSE00000681807 Chr2:152088919..152089029 TGGCCTGGATGGTAAAACTC Chr2:152088968..152088987 59.93 50
downstream ENSMUSE00000640038 Chr2:152098364..152098465 ACCCAAGCTCCACATATCCA Chr2:152098402..152098421 60.34 50
downstream ENSMUSE00000681805 Chr2:152098364..152098465 ACCCAAGCTCCACATATCCA Chr2:152098402..152098421 60.34 50
downstream ENSMUSE00000640037 Chr2:152099829..152099929 AACCTTGGCTATCCTCACCA Chr2:152099852..152099871 59.55 50
downstream ENSMUSE00000681804 Chr2:152099829..152099929 AACCTTGGCTATCCTCACCA Chr2:152099852..152099871 59.55 50
downstream ENSMUSE00000640036 Chr2:152101134..152101282 TCACTGTGGACAAAGCGTTC Chr2:152101175..152101194 59.88 50
downstream ENSMUSE00000681802 Chr2:152101134..152101282 TCACTGTGGACAAAGCGTTC Chr2:152101175..152101194 59.88 50
downstream ENSMUSE00000640035 Chr2:152102683..152102769 GCCTGGTCCTTCACAACAGT Chr2:152102707..152102726 60.16 55
downstream ENSMUSE00000681801 Chr2:152102683..152102769 GCCTGGTCCTTCACAACAGT Chr2:152102707..152102726 60.16 55
downstream ENSMUSE00000539955 Chr2:152104705..152107581 AGTTATCCACAGCGGTCCAC Chr2:152107079..152107098 60 55
downstream ENSMUSE00000681799 Chr2:152104705..152106074 AAATCCACAAGCAACGGTTC Chr2:152104955..152104974 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCGTGTAACTGGCTTTGGT Chr2:152064751..152064771 59.8 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCGTGTAACTGGCTTTGGT Chr2:152064751..152064771 59.8 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074698