Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13213
Trapped Gene
Trpc4ap (ENSMUSG00000038324)
Vector Insertion
Chr 2: 155496893 - 155498725
Public Clones CMHD-GT_298A7-3 (cmhd) CMHD-GT_334H7-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000324018 (Chr2:155498726..155498854 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTTTTGACCGAGAGGGACA Chr2:155498824..155498843 60.22 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000324018 (Chr2:155498726..155498854 -)
Downstram Exon
ENSMUSE00000505331 (Chr2:155496776..155496892 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTTTTGACCGAGAGGGACA Chr2:155498824..155498843 60.22 50 AAACGCCATAGCCTCCATAG Chr2:155496832..155496851 59.21 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000365190 Chr2:155517875..155518057 No primer for this exon
upstream ENSMUSE00000324018 Chr2:155498726..155498854 CTTTTTGACCGAGAGGGACA Chr2:155498824..155498843 60.22 50

*** Putative Vector Insertion (Chr 2: 155496893 - 155498725) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000505331 Chr2:155496776..155496892 AAACGCCATAGCCTCCATAG Chr2:155496832..155496851 59.21 50
downstream ENSMUSE00000323999 Chr2:155494148..155494205 TCTGTCCCCGGATAGAGATG Chr2:155494135..155494154 60.03 55
downstream ENSMUSE00000323994 Chr2:155491938..155491993 GGATGCTCAAGCAGTCCTTC Chr2:155491936..155491955 59.96 55
downstream ENSMUSE00000323984 Chr2:155489393..155489521 CTGCCAAACGCTTCGTTACT Chr2:155489472..155489491 60.44 50
downstream ENSMUSE00000323977 Chr2:155483472..155483679 CGTGTGTTTGTCGTCATTCC Chr2:155483520..155483539 60.01 50
downstream ENSMUSE00000323970 Chr2:155479229..155479414 TCTAGCACCAACGCATTGTC Chr2:155479251..155479270 59.87 50
downstream ENSMUSE00000352533 Chr2:155476155..155476321 TCCTCCGAAGTGCCTAGAGA Chr2:155476263..155476282 60.09 55
downstream ENSMUSE00000661377 Chr2:155476155..155476297 CAGCACGCAGAGGACATAAA Chr2:155476157..155476176 60.01 50
downstream ENSMUSE00000323952 Chr2:155470664..155470795 CTCAGCAATCATCCTGTGGA Chr2:155470753..155470772 59.79 50
downstream ENSMUSE00000323947 Chr2:155469128..155469186 No primer for this exon
downstream ENSMUSE00000323942 Chr2:155467325..155467426 ATGTTGGCTTTCAGCGAGAT Chr2:155467336..155467355 59.84 45
downstream ENSMUSE00000323935 Chr2:155466210..155466293 GCAGCAGCCGAGTTAGTAGG Chr2:155466225..155466244 60.18 60
downstream ENSMUSE00000323928 Chr2:155465209..155465299 GGTCTGCATAGGAGGTGGTC Chr2:155465219..155465238 59.53 60
downstream ENSMUSE00000323922 Chr2:155463784..155463924 AGCTCTCCCAGGAGATCAAA Chr2:155463823..155463842 58.97 50
downstream ENSMUSE00000323916 Chr2:155463394..155463502 TCATGTCCACCTGGTTTTCA Chr2:155463375..155463394 59.94 45
downstream ENSMUSE00000323909 Chr2:155461932..155462044 TATTGATGAGGCGGAAGAGG Chr2:155461936..155461955 60.17 50
downstream ENSMUSE00000323902 Chr2:155460972..155461178 TCCTTGTGCAGGTAGTGCTG Chr2:155460975..155460994 60.05 55
downstream ENSMUSE00000384585 Chr2:155460046..155460876 CTTACCCTGGGGACAGTGAA Chr2:155460487..155460506 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTCGTTGAGTGCCAAAGC Chr2:155498733..155498753 60.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTTCGTTGAGTGCCAAAGC Chr2:155498733..155498753 60.44 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038324