Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13219
Trapped Gene
1700102P08Rik (ENSMUSG00000032611)
Vector Insertion
Chr 9: 108295971 - 108297624
Public Clones CMHD-GT_345H10-3 (cmhd) CMHD-GT_345H9-3 (cmhd)
Private Clones OST376943 (lexicon) OST321604 (lexicon) OST279922 (lexicon) OST257287 (lexicon)
OST257203 (lexicon) OST107389 (lexicon)
Severity of mutation (?) Insertion after 53% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221541 (Chr9:108295566..108295970 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACCTCTGACCAGCAAGGAA Chr9:108295859..108295878 59.84 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221541 (Chr9:108295566..108295970 +)
Downstram Exon
ENSMUSE00000243784 (Chr9:108297625..108297716 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACCTCTGACCAGCAAGGAA Chr9:108295859..108295878 59.84 50 TCCTTTGTGACCTCTTGGCTA Chr9:108297701..108297721 59.86 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000221542 Chr9:108295165..108295190 No primer for this exon
upstream ENSMUSE00000221541 Chr9:108295566..108295970 AACCTCTGACCAGCAAGGAA Chr9:108295859..108295878 59.84 50

*** Putative Vector Insertion (Chr 9: 108295971 - 108297624) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000243784 Chr9:108297625..108297716 TCCTTTGTGACCTCTTGGCTA Chr9:108297701..108297721 59.86 47.62
downstream ENSMUSE00000221540 Chr9:108299524..108300096 AAGGGTGAATCTTGGCAGTG Chr9:108299623..108299642 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATGGGGAAGACTGGAGAAA Chr9:108295940..108295960 59.06 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATGGGGAAGACTGGAGAAA Chr9:108295940..108295960 59.06 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032611