Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1322
Trapped Gene
Ppp1ca (ENSMUSG00000040385)
Vector Insertion
Chr 19: 4193253 - 4193766
Public Clones DC0085 (sanger) E067A05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 43% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000461425 (Chr19:4193022..4193252 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTATGTAGATCGGGGCAAGC Chr19:4193110..4193129 60.06 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000461425 (Chr19:4193022..4193252 +)
Downstram Exon
ENSMUSE00000245838 (Chr19:4193767..4193871 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTATGTAGATCGGGGCAAGC Chr19:4193110..4193129 60.06 50 CAGGCAGTTGAAGCAGTCAG Chr19:4193828..4193847 59.77 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000245916 Chr19:4192178..4192271 GACAGCGAGAAGCTCAACCT Chr19:4192223..4192242 59.75 55
upstream ENSMUSE00000697240 Chr19:4192434..4192485 No primer for this exon
upstream ENSMUSE00000245885 Chr19:4192745..4192876 AAGAACGTGCAGCTGACAGA Chr19:4192765..4192784 59.78 50
upstream ENSMUSE00000461425 Chr19:4193022..4193252 TTATGTAGATCGGGGCAAGC Chr19:4193110..4193129 60.06 50

*** Putative Vector Insertion (Chr 19: 4193253 - 4193766) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000245838 Chr19:4193767..4193871 CAGGCAGTTGAAGCAGTCAG Chr19:4193828..4193847 59.77 55
downstream ENSMUSE00000245819 Chr19:4194467..4194690 AGGAGACACCACGGTCATTC Chr19:4194619..4194638 59.97 55
downstream ENSMUSE00000245799 Chr19:4194772..4194906 CTCCACAGTAGTTGGGAGCTG Chr19:4194849..4194869 59.92 57.14
downstream ENSMUSE00000394395 Chr19:4194982..4195419 CACAATCTGGTCTGCCATTG Chr19:4195340..4195359 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCTCTTTAATCGCCTTGC Chr19:4193296..4193316 60.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAACCGCATTTATGGCTTCT Chr19:4193225..4193245 60.1 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040385