Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13223
Trapped Gene
Map1lc3b (ENSMUSG00000031812)
Vector Insertion
Chr 8: 124114465 - 124117389
Public Clones D124C08 (ggtc) CMHD-GT_323B8-3 (cmhd) CMHD-GT_519H12-3 (cmhd) IST10084G8 (tigm)
Private Clones OST417582 (lexicon) OST171987 (lexicon) OST122833 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000462223 (Chr8:124114377..124114464 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCCGAGAAGACCTTCAAGC Chr8:124114430..124114449 59.02 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000462223 (Chr8:124114377..124114464 +)
Downstram Exon
ENSMUSE00000521424 (Chr8:124117390..124117445 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCCGAGAAGACCTTCAAGC Chr8:124114430..124114449 59.02 55 CCGGACATCTTCCACTCTTT Chr8:124117415..124117434 59.14 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000462223 Chr8:124114377..124114464 GTCCGAGAAGACCTTCAAGC Chr8:124114430..124114449 59.02 55

*** Putative Vector Insertion (Chr 8: 124114465 - 124117389) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000521424 Chr8:124117390..124117445 CCGGACATCTTCCACTCTTT Chr8:124117415..124117434 59.14 50
downstream ENSMUSE00000487435 Chr8:124119886..124119992 CTCCCCCTTGTATCGCTCTA Chr8:124119915..124119934 59.29 55
downstream ENSMUSE00000476335 Chr8:124120496..124121946 GCTTAAGCTGGGTCAGCAAC Chr8:124121285..124121304 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATAATCGCCTTGCAGCACA Chr8:124114514..124114534 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGACGTGACTGGGAAAACC Chr8:124114512..124114532 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031812