Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13229
Trapped Gene
Polr2h (ENSMUSG00000021018)
Vector Insertion
Chr 16: 20718068 - 20718896
Public Clones CMHD-GT_345E7-3 (cmhd)
Private Clones OST434699 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000644905 (Chr16:20717875..20718067 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000644905 (Chr16:20717875..20718067 +)
Downstram Exon
ENSMUSE00000113956 (Chr16:20718897..20718980 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644905 Chr16:20717875..20718067 No primer for this exon

*** Putative Vector Insertion (Chr 16: 20718068 - 20718896) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000113956 Chr16:20718897..20718980 No primer for this exon
downstream ENSMUSE00000131240 Chr16:20719064..20719157 No primer for this exon
downstream ENSMUSE00000131239 Chr16:20720592..20720675 No primer for this exon
downstream ENSMUSE00000369022 Chr16:20721983..20722337 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAACATGCCCACCCACTAAT Chr16:20718103..20718123 60.64 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAAGACATCGACCCAGAA Chr16:20718030..20718050 59.22 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021018