Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13259
Trapped Gene
Vapb (ENSMUSG00000054455)
Vector Insertion
Chr 2: 173597126 - 173599894
Public Clones D123B04 (ggtc) D123B02 (ggtc) CMHD-GT_340C12-3 (cmhd) IST14728B4 (tigm)
IST13051C2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000170240 (Chr2:173597022..173597125 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCGCCTGACACTTCTGAT Chr2:173597094..173597113 60.41 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000170240 (Chr2:173597022..173597125 +)
Downstram Exon
ENSMUSE00000170243 (Chr2:173599895..173599975 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCGCCTGACACTTCTGAT Chr2:173597094..173597113 60.41 55 TCTGCTGGCAATTCAAACAC Chr2:173599965..173599984 59.85 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000349103 Chr2:173563083..173563251 AAGGTGGAACAGGTCCTGAG Chr2:173563200..173563219 59.15 55
upstream ENSMUSE00000548835 Chr2:173587618..173587770 CCAACAGACCGAAATGTGTG Chr2:173587662..173587681 60 50
upstream ENSMUSE00000170240 Chr2:173597022..173597125 CTCCGCCTGACACTTCTGAT Chr2:173597094..173597113 60.41 55

*** Putative Vector Insertion (Chr 2: 173597126 - 173599894) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000170243 Chr2:173599895..173599975 TCTGCTGGCAATTCAAACAC Chr2:173599965..173599984 59.85 45
downstream ENSMUSE00000170242 Chr2:173601613..173601789 TTCTGTCTTGGATGCACTCG Chr2:173601666..173601685 59.98 50
downstream ENSMUSE00000446334 Chr2:173603564..173604849 GTCCTACGGCAACAGACCAT Chr2:173603968..173603987 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr2:173597176..173597196 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCGCCTGACACTTCTGATA Chr2:173597096..173597116 59.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054455