Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13270
Trapped Gene
Wdr82 (ENSMUSG00000020257)
Vector Insertion
Chr 9: 106079042 - 106082896
Public Clones (sanger) CMHD-GT_340C8-3 (cmhd) CMHD-GT_334B5-3 (cmhd) FHCRC-GT-S9-3C1 (fhcrc)
Private Clones OST435332 (lexicon) OST219420 (lexicon)
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000354037 (Chr9:106078944..106079041 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000354037 (Chr9:106078944..106079041 +)
Downstram Exon
ENSMUSE00000263610 (Chr9:106082897..106082963 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000401886 Chr9:106073260..106073710 No primer for this exon
upstream ENSMUSE00000354037 Chr9:106078944..106079041 No primer for this exon

*** Putative Vector Insertion (Chr 9: 106079042 - 106082896) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000263610 Chr9:106082897..106082963 No primer for this exon
downstream ENSMUSE00000263591 Chr9:106085947..106086046 No primer for this exon
downstream ENSMUSE00000263577 Chr9:106086511..106086627 No primer for this exon
downstream ENSMUSE00000263556 Chr9:106087014..106087169 No primer for this exon
downstream ENSMUSE00000263537 Chr9:106087580..106087649 No primer for this exon
downstream ENSMUSE00000102646 Chr9:106088701..106088843 No primer for this exon
downstream ENSMUSE00000349267 Chr9:106090927..106093452 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCAACACAGTCGTTTACAGC Chr9:106079006..106079027 60.75 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCAACACAGTCGTTTACAGC Chr9:106079006..106079027 60.75 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020257