Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13286
Trapped Gene
Rpl24 (ENSMUSG00000022601)
Vector Insertion
Chr 16: 55966552 - 55966659
Public Clones CMHD-GT_336D9-3 (cmhd)
Private Clones OST124539 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000718751 (Chr16:55966456..55966551 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTCTTCGCCATCTTTACCC Chr16:55966505..55966524 59.27 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000718751 (Chr16:55966456..55966551 +)
Downstram Exon
ENSMUSE00000223023 (Chr16:55966660..55966735 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTCTTCGCCATCTTTACCC Chr16:55966505..55966524 59.27 50 CTTGTACCCGCTGAAACTGC Chr16:55966693..55966712 60.83 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718751 Chr16:55966456..55966551 TCTCTTCGCCATCTTTACCC Chr16:55966505..55966524 59.27 50
upstream ENSMUSE00000699413 Chr16:55966501..55966551 TCTCTTCGCCATCTTTACCC Chr16:55966505..55966524 59.27 50
upstream ENSMUSE00000364485 Chr16:55966506..55966551 AGGCCGACATCTATCACCAT Chr16:55966529..55966548 59.39 50

*** Putative Vector Insertion (Chr 16: 55966552 - 55966659) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000223023 Chr16:55966660..55966735 CTTGTACCCGCTGAAACTGC Chr16:55966693..55966712 60.83 55
downstream ENSMUSE00000128658 Chr16:55967173..55967283 ATCTGCCGAGGATTCCTTTT Chr16:55967240..55967259 60.04 45
downstream ENSMUSE00000128665 Chr16:55969623..55969759 GTGATGGCTCGTTGGAATTT Chr16:55969681..55969700 59.94 45
downstream ENSMUSE00000128661 Chr16:55970225..55970288 TGATGCCTGCTTAGCCTTTT Chr16:55970264..55970283 59.98 45
downstream ENSMUSE00000222998 Chr16:55971424..55971547 ACACTAGCGTTTCCCACCAA Chr16:55971510..55971529 60.55 50
downstream ENSMUSE00000713691 Chr16:55980708..55980834 TTTCCGAAGCATCCGATATT Chr16:55980803..55980822 59.51 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr16:55966602..55966622 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCGACATCTATCACCATGA Chr16:55966532..55966552 59.48 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022601