Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1329
Trapped Gene
Mat2a (ENSMUSG00000053907)
Vector Insertion
Chr 6: 72387443 - 72389339
Public Clones DC0045 (sanger) (sanger) E077H10 (ggtc) D067B05 (ggtc) PST17638-NR (escells)
PST22449-NL (escells) PST13865-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000429035 (Chr6:72389340..72389550 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGGGACGTTCCTCTTCACT Chr6:72389368..72389387 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000429035 (Chr6:72389340..72389550 -)
Downstram Exon
ENSMUSE00000429009 (Chr6:72387365..72387442 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGGGACGTTCCTCTTCACT Chr6:72389368..72389387 60.11 55 GTGTGCATCAAGGACAGCAT Chr6:72387377..72387396 59.71 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000429035 Chr6:72389340..72389550 AGGGGACGTTCCTCTTCACT Chr6:72389368..72389387 60.11 55

*** Putative Vector Insertion (Chr 6: 72387443 - 72389339) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000429009 Chr6:72387365..72387442 GTGTGCATCAAGGACAGCAT Chr6:72387377..72387396 59.71 50
downstream ENSMUSE00000428558 Chr6:72386989..72387111 GGATGTAATTTCCCCAGCAA Chr6:72387040..72387059 59.76 45
downstream ENSMUSE00000428552 Chr6:72386411..72386523 ACTGTTGTTCCAAGGCAACC Chr6:72386454..72386473 60.01 50
downstream ENSMUSE00000428543 Chr6:72386191..72386334 ATGTACCATTGCGGCGTAGT Chr6:72386201..72386220 60.42 50
downstream ENSMUSE00000428538 Chr6:72385805..72386023 TTGCAGGTACAACAGCCTTG Chr6:72385851..72385870 59.9 50
downstream ENSMUSE00000559585 Chr6:72385302..72385382 ATGATTTTTCGGCCAGTCAG Chr6:72385329..72385348 60.07 45
downstream ENSMUSE00000559584 Chr6:72385231..72385296 GAGCAGCATAAGCAGCTGAA Chr6:72385234..72385253 59.47 50
downstream ENSMUSE00000428529 Chr6:72385200..72385382 ATGATTTTTCGGCCAGTCAG Chr6:72385329..72385348 60.07 45
downstream ENSMUSE00000615638 Chr6:72384975..72385108 TGGAGATCGACAATGGATGA Chr6:72385044..72385063 60.01 45
downstream ENSMUSE00000615637 Chr6:72382793..72384389 CCAACAAGTCTGGGGAAAAA Chr6:72384233..72384252 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGAGTCTGTAGGGGAAGGT Chr6:72389345..72389365 60.5 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGAGTCTGTAGGGGAAGGT Chr6:72389345..72389365 60.5 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTCCCTCTTAATCGCCTTGC Chr6:72389488..72389508 61.21 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCTCTCGTGACTGGGAAAAC Chr6:72389485..72389505 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053907