Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13299
Trapped Gene
Rbm42 (ENSMUSG00000036733)
Vector Insertion
Chr 7: 31434739 - 31434956
Public Clones CMHD-GT_329F12-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000675741 (Chr7:31434957..31435163 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAGAAATGGAGGCGGAGAT Chr7:31434963..31434982 60.04 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000675741 (Chr7:31434957..31435163 -)
Downstram Exon
ENSMUSE00000242805 (Chr7:31434603..31434738 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAGAAATGGAGGCGGAGAT Chr7:31434963..31434982 60.04 45 GATAATTGGGCGGATCACAG Chr7:31434602..31434621 60.3 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000242812 Chr7:31434957..31435184 AAAGAAATGGAGGCGGAGAT Chr7:31434963..31434982 60.04 45
upstream ENSMUSE00000675741 Chr7:31434957..31435163 AAAGAAATGGAGGCGGAGAT Chr7:31434963..31434982 60.04 45
upstream ENSMUSE00000675743 Chr7:31434957..31435336 AAAGAAATGGAGGCGGAGAT Chr7:31434963..31434982 60.04 45

*** Putative Vector Insertion (Chr 7: 31434739 - 31434956) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000242805 Chr7:31434603..31434738 GATAATTGGGCGGATCACAG Chr7:31434602..31434621 60.3 50
downstream ENSMUSE00000242800 Chr7:31432750..31432834 CCATGGGAGGAACAACTGTG Chr7:31432755..31432774 61.37 55
downstream ENSMUSE00000242796 Chr7:31432579..31432653 CTCTCGAGCCTCAGGACTGT Chr7:31432579..31432598 59.73 60
downstream ENSMUSE00000242791 Chr7:31430938..31431003 No primer for this exon
downstream ENSMUSE00000242784 Chr7:31430686..31430861 No primer for this exon
downstream ENSMUSE00000675740 Chr7:31430686..31430840 TCTCAGAGCAGCCATAGAACC Chr7:31430673..31430693 59.59 52.38
downstream ENSMUSE00000242778 Chr7:31429845..31430177 GTGGACGGAGAGACAAGAGC Chr7:31429873..31429892 59.99 60
downstream ENSMUSE00000242772 Chr7:31429518..31429635 TTTCTCTGGCTTGCCTTTCT Chr7:31429566..31429585 59.19 45
downstream ENSMUSE00000242765 Chr7:31426327..31426521 GTTCACCTCATTGCCCAGAT Chr7:31426456..31426475 59.93 50
downstream ENSMUSE00000675744 Chr7:31426021..31426239 ATGCTTTTGCGAAGCTTGAT Chr7:31426175..31426194 59.99 40
downstream ENSMUSE00000412401 Chr7:31426018..31426239 ATGCTTTTGCGAAGCTTGAT Chr7:31426175..31426194 59.99 40
downstream ENSMUSE00000675742 Chr7:31426013..31426239 ATGCTTTTGCGAAGCTTGAT Chr7:31426175..31426194 59.99 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAGAAATGGAGGCGGAGAT Chr7:31434961..31434981 60.04 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAGAAATGGAGGCGGAGAT Chr7:31434961..31434981 60.04 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036733