Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13302
Trapped Gene
D17Wsu92e (ENSMUSG00000056692)
Vector Insertion
Chr 17: 27905080 - 27905185
Public Clones CMHD-GT_340C2-3 (cmhd)
Private Clones OST427116 (lexicon)
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000700825 (Chr17:27905081..27905184 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTAACGCAGCAGCTGTCATC Chr17:27905118..27905137 59.63 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000700825 (Chr17:27905081..27905184 -)
Downstram Exon
ENSMUSE00000700820 (Chr17:27904434..27905184 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTAACGCAGCAGCTGTCATC Chr17:27905118..27905137 59.63 55 GGCAGTGGTGGTCTAGCATT Chr17:27904744..27904763 60.14 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000610260 Chr17:27957122..27957487 ACGTGCTCATCTCCGAGTTC Chr17:27957187..27957206 60.42 55
upstream ENSMUSE00000700826 Chr17:27957122..27957436 ACGTGCTCATCTCCGAGTTC Chr17:27957187..27957206 60.42 55
upstream ENSMUSE00000713263 Chr17:27957122..27957487 ACGTGCTCATCTCCGAGTTC Chr17:27957187..27957206 60.42 55
upstream ENSMUSE00000449145 Chr17:27930854..27931008 CGATTGGCGCCTATTATGAC Chr17:27930975..27930994 60.44 50
upstream ENSMUSE00000449130 Chr17:27923016..27923213 ATATGTCGGGGGAGACCAGT Chr17:27923160..27923179 60.6 55
upstream ENSMUSE00000700825 Chr17:27905081..27905184 GTAACGCAGCAGCTGTCATC Chr17:27905118..27905137 59.63 55

*** Putative Vector Insertion (Chr 17: 27905080 - 27905185) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000449140 Chr17:27904856..27905184 ACAGCTGCTGCGTTACTCCT Chr17:27905100..27905119 60.22 55
downstream ENSMUSE00000700820 Chr17:27904434..27905184 GGCAGTGGTGGTCTAGCATT Chr17:27904744..27904763 60.14 55
downstream ENSMUSE00000700822 Chr17:27888191..27890940 TCCTGCAGTTCAGCATTCAC Chr17:27890678..27890697 59.99 50
downstream ENSMUSE00000700827 Chr17:27888181..27890940 TCCTGCAGTTCAGCATTCAC Chr17:27890678..27890697 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAGGTGGGTGGACTTTTA Chr17:27905139..27905159 60.35 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAGGTGGGTGGACTTTTA Chr17:27905139..27905159 60.35 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056692