Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13318
Trapped Gene
Rab11fip1 (ENSMUSG00000031488)
Vector Insertion
Chr 8: 28267142 - 28284680
Public Clones CMHD-GT_340A8-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000210016 (Chr8:28284681..28285120 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGGTGGGCAAGGAGAAGTA Chr8:28284903..28284922 60.25 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000210016 (Chr8:28284681..28285120 -)
Downstram Exon
ENSMUSE00000210018 (Chr8:28266699..28267141 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGGTGGGCAAGGAGAAGTA Chr8:28284903..28284922 60.25 55 CTGGCCGTCATGTTATTCCT Chr8:28267024..28267043 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000210016 Chr8:28284681..28285120 CAGGTGGGCAAGGAGAAGTA Chr8:28284903..28284922 60.25 55

*** Putative Vector Insertion (Chr 8: 28267142 - 28284680) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000210018 Chr8:28266699..28267141 CTGGCCGTCATGTTATTCCT Chr8:28267024..28267043 59.96 50
downstream ENSMUSE00000210015 Chr8:28264618..28265407 AAGTTGGACTGGTTCGGTTG Chr8:28265331..28265350 60.01 50
downstream ENSMUSE00000429989 Chr8:28262069..28263631 TGCTTGTTTTTGCGATTCTG Chr8:28262181..28262200 59.99 40
downstream ENSMUSE00000210014 Chr8:28261167..28261275 TTGGTGGCTGTTGTGTTCAT Chr8:28261215..28261234 60.01 45
downstream ENSMUSE00000471152 Chr8:28249245..28253866 CCGTGTGTGTGTGTGTGTGT Chr8:28251728..28251747 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGAAGAAGCAGTGAGTGG Chr8:28281671..28281691 58.59 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAAGAGCGTGACTGGGAAA Chr8:28281616..28281636 59.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031488