Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13342
Trapped Gene
Eef2k (ENSMUSG00000035064)
Vector Insertion
Chr 7: 128043887 - 128046795
Public Clones CMHD-GT_329C9-3 (cmhd) CMHD-GT_498F5-3 (cmhd) CMHD-GT_173C3-3 (cmhd) CMHD-GT_173A8-3 (cmhd)
Private Clones OST24237 (lexicon) OST7551 (lexicon) OST5416 (lexicon)
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000670162 (Chr7:128043775..128043886 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTAGGCCAGTGGACCTCAAA Chr7:128043789..128043808 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000670162 (Chr7:128043775..128043886 +)
Downstram Exon
ENSMUSE00000670166 (Chr7:128046796..128047010 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTAGGCCAGTGGACCTCAAA Chr7:128043789..128043808 60.11 55 CCGCCTTCTCGTAGTACTGG Chr7:128046879..128046898 59.89 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000463208 Chr7:127986369..127986614 TTTGTACCGGGGATTCTCCT Chr7:127986494..127986513 60.68 50
upstream ENSMUSE00000670168 Chr7:127987114..127987299 GGGGAGTATTTCTGCGTCCT Chr7:127987185..127987204 60.46 55
upstream ENSMUSE00000670164 Chr7:127994703..127994883 GGTCACAAGGTAGGCAAGGA Chr7:127994792..127994811 60.11 55
upstream ENSMUSE00000670167 Chr7:127994715..127994883 GGTCACAAGGTAGGCAAGGA Chr7:127994792..127994811 60.11 55
upstream ENSMUSE00000261270 Chr7:128001858..128002176 GCAGTAACTCTGGCTGCACA Chr7:128001879..128001898 60.21 55
upstream ENSMUSE00000716617 Chr7:128001858..128002176 GCAGTAACTCTGGCTGCACA Chr7:128001879..128001898 60.21 55
upstream ENSMUSE00000261263 Chr7:128016823..128016923 ATCGAGAAAGCCAAGCACAT Chr7:128016841..128016860 59.84 45
upstream ENSMUSE00000261256 Chr7:128019946..128020006 GGCTGAAAGACGAGGTTCTG Chr7:128019969..128019988 59.99 55
upstream ENSMUSE00000261249 Chr7:128023328..128023365 AATGAGGGAGTGCTTCAGGA Chr7:128023345..128023364 59.8 50
upstream ENSMUSE00000261243 Chr7:128023819..128023990 GGTGGACAGGAGCGTGTACT Chr7:128023897..128023916 60.18 60
upstream ENSMUSE00000261239 Chr7:128028172..128028321 AACATCCGACTAACCCCACA Chr7:128028301..128028320 60.23 50
upstream ENSMUSE00000261230 Chr7:128028936..128029068 ATACCGACCCACAGATCCAC Chr7:128029012..128029031 59.66 55
upstream ENSMUSE00000261220 Chr7:128029324..128029451 AACCGGATTTGTCAGAGCAT Chr7:128029365..128029384 59.56 45
upstream ENSMUSE00000632652 Chr7:128029324..128029400 GGGGAATGGCTCTCTTCTTC Chr7:128029330..128029349 60.15 55
upstream ENSMUSE00000670163 Chr7:128029324..128029399 AACCGGATTTGTCAGAGCAT Chr7:128029365..128029384 59.56 45
upstream ENSMUSE00000261211 Chr7:128030100..128030301 CTCCCCGTCTTCAGCTACAC Chr7:128030255..128030274 59.87 60
upstream ENSMUSE00000261204 Chr7:128031373..128031440 TCGATAACATGGGCCCTAGA Chr7:128031394..128031413 60.43 50
upstream ENSMUSE00000632650 Chr7:128031389..128031440 TCGATAACATGGGCCCTAGA Chr7:128031394..128031413 60.43 50
upstream ENSMUSE00000670165 Chr7:128031390..128031440 TCGATAACATGGGCCCTAGA Chr7:128031394..128031413 60.43 50
upstream ENSMUSE00000261198 Chr7:128032704..128032781 GTGGGTATCCAAGCGAGAAG Chr7:128032726..128032745 59.69 55
upstream ENSMUSE00000261191 Chr7:128033203..128033265 AGGCATGAATCTGACGAGGA Chr7:128033224..128033243 60.77 50
upstream ENSMUSE00000261184 Chr7:128035110..128035244 GTGGCCCTAGAAGTGCAGAG Chr7:128035173..128035192 60.01 60
upstream ENSMUSE00000261177 Chr7:128035379..128035567 CTTCTGCGAGAAGGATGAGG Chr7:128035417..128035436 60.09 55
upstream ENSMUSE00000261172 Chr7:128038698..128038822 ACTTACTGAAGGCGGCAGAA Chr7:128038732..128038751 60.01 50
upstream ENSMUSE00000261164 Chr7:128042882..128043060 ACGATGGGATACAGGACGAG Chr7:128042959..128042978 59.95 55
upstream ENSMUSE00000632649 Chr7:128043775..128043824 GTAGGCCAGTGGACCTCAAA Chr7:128043789..128043808 60.11 55
upstream ENSMUSE00000670162 Chr7:128043775..128043886 GTAGGCCAGTGGACCTCAAA Chr7:128043789..128043808 60.11 55

*** Putative Vector Insertion (Chr 7: 128043887 - 128046795) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000423966 Chr7:128046796..128047508 CCGCCTTCTCGTAGTACTGG Chr7:128046879..128046898 59.89 60
downstream ENSMUSE00000670166 Chr7:128046796..128047010 CCGCCTTCTCGTAGTACTGG Chr7:128046879..128046898 59.89 60
downstream ENSMUSE00000705530 Chr7:128046796..128047011 CCGCCTTCTCGTAGTACTGG Chr7:128046879..128046898 59.89 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr7:128043938..128043958 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000035064