Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13347
Trapped Gene
Parp9 (ENSMUSG00000022906)
Vector Insertion
Chr 16: 35971920 - 35972690
Public Clones CMHD-GT_543A3-3 (cmhd) CMHD-GT_322C6-3 (cmhd) CMHD-GT_380G11-3 (cmhd) CMHD-GT_322B12-3 (cmhd)
CMHD-GT_396C12-3 (cmhd) CMHD-GT_322A12-3 (cmhd)
Private Clones OST17839 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000411705 (Chr16:35971921..35972691 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTAAAGGCACCGACCACAC Chr16:35972402..35972421 60.03 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000411705 (Chr16:35971921..35972691 +)
Downstram Exon
ENSMUSE00000700890 (Chr16:35971921..35972689 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTAAAGGCACCGACCACAC Chr16:35972402..35972421 60.03 55 ACTGCAGCGAAGAGACCATT Chr16:35972283..35972302 60.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700910 Chr16:35938556..35939146 AAGACCCGAGAGGCAAAGTT Chr16:35939040..35939059 60.25 50
upstream ENSMUSE00000700871 Chr16:35939097..35939146 TGTCTTGCTCTGCCATCTCT Chr16:35939112..35939131 58.7 50
upstream ENSMUSE00000700878 Chr16:35939098..35939146 TGTCTTGCTCTGCCATCTCT Chr16:35939112..35939131 58.7 50
upstream ENSMUSE00000709435 Chr16:35941119..35941221 CCACCATCTCCTCGATCTACA Chr16:35941126..35941146 60.08 52.38
upstream ENSMUSE00000713856 Chr16:35941119..35941221 CCACCATCTCCTCGATCTACA Chr16:35941126..35941146 60.08 52.38
upstream ENSMUSE00000714765 Chr16:35941119..35941221 CCACCATCTCCTCGATCTACA Chr16:35941126..35941146 60.08 52.38
upstream ENSMUSE00000325448 Chr16:35943455..35943596 GAAGAGGGCACTCAGAAGGA Chr16:35943552..35943571 59.53 55
upstream ENSMUSE00000700886 Chr16:35943455..35943488 No primer for this exon
upstream ENSMUSE00000131815 Chr16:35947587..35948440 TCGGTGGACAGTTACGAACA Chr16:35948032..35948051 60.15 50
upstream ENSMUSE00000700868 Chr16:35947587..35948440 TCGGTGGACAGTTACGAACA Chr16:35948032..35948051 60.15 50
upstream ENSMUSE00000131814 Chr16:35953649..35953864 GGTGTGGGTCACAAAAGGAT Chr16:35953783..35953802 59.68 50
upstream ENSMUSE00000131818 Chr16:35956893..35957111 CTCTCGGGACAGGATTGATG Chr16:35956966..35956985 60.61 55
upstream ENSMUSE00000131823 Chr16:35960090..35960147 AAGGTCCAACGAGCTGAATC Chr16:35960113..35960132 59.29 50
upstream ENSMUSE00000325416 Chr16:35964061..35964450 CGGCCACTTTGGAGATTAAA Chr16:35964322..35964341 60.07 45
upstream ENSMUSE00000325405 Chr16:35967736..35967872 TTCAACGATACCCAGCATCA Chr16:35967790..35967809 60.07 45
upstream ENSMUSE00000700874 Chr16:35967736..35968312 TTCAACGATACCCAGCATCA Chr16:35967790..35967809 60.07 45
upstream ENSMUSE00000131816 Chr16:35969677..35969851 AGTCGGCTTCCACAGAATGT Chr16:35969817..35969836 59.73 50

*** Putative Vector Insertion (Chr 16: 35971920 - 35972690) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000411705 Chr16:35971921..35972691 ACTGCAGCGAAGAGACCATT Chr16:35972283..35972302 60.02 50
downstream ENSMUSE00000700890 Chr16:35971921..35972689 ACTGCAGCGAAGAGACCATT Chr16:35972283..35972302 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGCCGGCATATATTTCAC Chr16:35971933..35971953 59.4 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCTCGTGACTGGGAAAACC Chr16:35971967..35971987 58.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022906