Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13358
Trapped Gene
Jam2 (ENSMUSG00000053062)
Vector Insertion
Chr 16: 84774799 - 84801814
Public Clones CMHD-GT_332F5-3 (cmhd) FHCRC-GT-S1-8E1 (fhcrc) FHCRC-GT-UAS-2H5 (fhcrc)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000698466 (Chr16:84774631..84774798 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATGCTGCTGCTGCTACACT Chr16:84774758..84774777 59.37 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000698466 (Chr16:84774631..84774798 +)
Downstram Exon
ENSMUSE00000268247 (Chr16:84801815..84801883 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATGCTGCTGCTGCTACACT Chr16:84774758..84774777 59.37 55 TTGACGGTGGTCTTTTGATG Chr16:84801861..84801880 59.54 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698472 Chr16:84774368..84774798 GTCCTAGGGCCAGAAGACCT Chr16:84774523..84774542 59.7 60
upstream ENSMUSE00000465097 Chr16:84774528..84774798 GACTGACATCGGGACAGGAC Chr16:84774582..84774601 60.54 60
upstream ENSMUSE00000698466 Chr16:84774631..84774798 GATGCTGCTGCTGCTACACT Chr16:84774758..84774777 59.37 55

*** Putative Vector Insertion (Chr 16: 84774799 - 84801814) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000268247 Chr16:84801815..84801883 TTGACGGTGGTCTTTTGATG Chr16:84801861..84801880 59.54 45
downstream ENSMUSE00000268240 Chr16:84807080..84807187 TGGGGTTTTACAAGCCAAAA Chr16:84807108..84807127 60.33 40
downstream ENSMUSE00000496500 Chr16:84809589..84809741 CACAGCGATACTCTCCAGCA Chr16:84809678..84809697 60.16 55
downstream ENSMUSE00000634408 Chr16:84809589..84811241 TTCCAGACCCTAGCATGGAC Chr16:84809998..84810017 60.07 55
downstream ENSMUSE00000131665 Chr16:84813144..84813343 CCTTCTTTATCCTGGCATCG Chr16:84813231..84813250 59.66 50
downstream ENSMUSE00000131671 Chr16:84815414..84815513 CTCCACTGTCCATCTTGGAA Chr16:84815450..84815469 58.64 50
downstream ENSMUSE00000131673 Chr16:84816511..84816618 ACCACCACAACCGTTGCTAT Chr16:84816556..84816575 60.3 50
downstream ENSMUSE00000698469 Chr16:84819005..84819020 No primer for this exon
downstream ENSMUSE00000131670 Chr16:84821505..84821547 No primer for this exon
downstream ENSMUSE00000404528 Chr16:84823032..84823128 TTTGGTGCAGCTCAAAACTG Chr16:84823095..84823114 60.03 45
downstream ENSMUSE00000698468 Chr16:84823032..84826173 TTTGGTGCAGCTCAAAACTG Chr16:84823095..84823114 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCTCTGTGGGTCCTATCCT Chr16:84780814..84780834 60.48 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCTCTGTGGGTCCTATCCT Chr16:84780814..84780834 60.48 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053062