Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13373
Trapped Gene
Parp9 (ENSMUSG00000022906)
Vector Insertion
Chr 16: 35964451 - 35967735
Public Clones CMHD-GT_536F10-3 (cmhd) CMHD-GT_309E11-3 (cmhd) CMHD-GT_536F10-5S (cmhd) IST10437G12 (tigm)
IST15107D9 (tigm) IST11251D6 (tigm) IST14758E1 (tigm) IST15107D9 (tigm)
IST10289D7 (tigm) IST14425E12 (tigm) IST13956A11 (tigm) IST12716G2 (tigm)
IST12242H12 (tigm) IST12100G10 (tigm) IST14865B9 (tigm) IST10813C3 (tigm)
IST10906B11 (tigm) IST11736G11 (tigm) IST12716G2 (tigm) IST11254H1 (tigm)
IST10130E9 (tigm) IST14324G5 (tigm) IST10813C3 (tigm) IST11313F11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000325416 (Chr16:35964061..35964450 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGCCACTTTGGAGATTAAA Chr16:35964322..35964341 60.07 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000325416 (Chr16:35964061..35964450 +)
Downstram Exon
ENSMUSE00000325405 (Chr16:35967736..35967872 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGCCACTTTGGAGATTAAA Chr16:35964322..35964341 60.07 45 TGATGCTGGGTATCGTTGAA Chr16:35967812..35967831 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700910 Chr16:35938556..35939146 AAGACCCGAGAGGCAAAGTT Chr16:35939040..35939059 60.25 50
upstream ENSMUSE00000700871 Chr16:35939097..35939146 TGTCTTGCTCTGCCATCTCT Chr16:35939112..35939131 58.7 50
upstream ENSMUSE00000700878 Chr16:35939098..35939146 TGTCTTGCTCTGCCATCTCT Chr16:35939112..35939131 58.7 50
upstream ENSMUSE00000709435 Chr16:35941119..35941221 CCACCATCTCCTCGATCTACA Chr16:35941126..35941146 60.08 52.38
upstream ENSMUSE00000713856 Chr16:35941119..35941221 CCACCATCTCCTCGATCTACA Chr16:35941126..35941146 60.08 52.38
upstream ENSMUSE00000714765 Chr16:35941119..35941221 CCACCATCTCCTCGATCTACA Chr16:35941126..35941146 60.08 52.38
upstream ENSMUSE00000325448 Chr16:35943455..35943596 GAAGAGGGCACTCAGAAGGA Chr16:35943552..35943571 59.53 55
upstream ENSMUSE00000700886 Chr16:35943455..35943488 No primer for this exon
upstream ENSMUSE00000131815 Chr16:35947587..35948440 TCGGTGGACAGTTACGAACA Chr16:35948032..35948051 60.15 50
upstream ENSMUSE00000700868 Chr16:35947587..35948440 TCGGTGGACAGTTACGAACA Chr16:35948032..35948051 60.15 50
upstream ENSMUSE00000131814 Chr16:35953649..35953864 GGTGTGGGTCACAAAAGGAT Chr16:35953783..35953802 59.68 50
upstream ENSMUSE00000131818 Chr16:35956893..35957111 CTCTCGGGACAGGATTGATG Chr16:35956966..35956985 60.61 55
upstream ENSMUSE00000131823 Chr16:35960090..35960147 AAGGTCCAACGAGCTGAATC Chr16:35960113..35960132 59.29 50
upstream ENSMUSE00000325416 Chr16:35964061..35964450 CGGCCACTTTGGAGATTAAA Chr16:35964322..35964341 60.07 45

*** Putative Vector Insertion (Chr 16: 35964451 - 35967735) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000325405 Chr16:35967736..35967872 TGATGCTGGGTATCGTTGAA Chr16:35967812..35967831 60.07 45
downstream ENSMUSE00000700874 Chr16:35967736..35968312 TGATGCTGGGTATCGTTGAA Chr16:35967812..35967831 60.07 45
downstream ENSMUSE00000131816 Chr16:35969677..35969851 CGACTCTGCACACCGTATTG Chr16:35969824..35969843 60.32 55
downstream ENSMUSE00000411705 Chr16:35971921..35972691 ACTGCAGCGAAGAGACCATT Chr16:35972283..35972302 60.02 50
downstream ENSMUSE00000700890 Chr16:35971921..35972689 ACTGCAGCGAAGAGACCATT Chr16:35972283..35972302 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCGGATTTACTTGTGGTGTCA Chr16:35964442..35964463 59.04 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCGGATTTACTTGTGGTGTCA Chr16:35964442..35964463 59.04 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022906