Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13377
Trapped Gene
Igll1 (ENSMUSG00000075370)
Vector Insertion
Chr 16: 16862638 - 16863788
Public Clones CMHD-GT_309B12-3 (cmhd) CMHD-GT_465F11-3 (cmhd) CMHD-GT_314A02-3 (cmhd) CMHD-GT_465G11-3 (cmhd)
CMHD-GT_477E6-3 (cmhd) FHCRC-GT-S5-2A1 (fhcrc) FHCRC-GT-S13-11D1 (fhcrc) PSTVUpb18a8 (vanderbilt)
Private Clones OST448302 (lexicon) OST401577 (lexicon) OST391765 (lexicon) OST327224 (lexicon)
OST323922 (lexicon) OST306723 (lexicon) OST291823 (lexicon) OST279919 (lexicon)
OST246026 (lexicon) OST236611 (lexicon) OST219124 (lexicon) OST217784 (lexicon)
OST206333 (lexicon) OST205369 (lexicon) OST177897 (lexicon) OST150447 (lexicon)
OST63685 (lexicon) OST61390 (lexicon) OST61280 (lexicon) OST57975 (lexicon)
OST38500 (lexicon) OST36121 (lexicon)
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000703998 (Chr16:16863789..16864078 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTGCTGTTGGGTCTAGTG Chr16:16863899..16863918 60.05 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000703998 (Chr16:16863789..16864078 -)
Downstram Exon
ENSMUSE00000645533 (Chr16:16862522..16862637 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTGCTGTTGGGTCTAGTG Chr16:16863899..16863918 60.05 55 CCAAAACTGGGGCTTAGATG Chr16:16862537..16862556 59.56 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703998 Chr16:16863789..16864078 TGCTGCTGTTGGGTCTAGTG Chr16:16863899..16863918 60.05 55

*** Putative Vector Insertion (Chr 16: 16862638 - 16863788) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000645533 Chr16:16862522..16862637 CCAAAACTGGGGCTTAGATG Chr16:16862537..16862556 59.56 50
downstream ENSMUSE00000645532 Chr16:16860908..16861227 GGGTAGAATTCGCTCACCAA Chr16:16861103..16861122 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGACTAGTAATCGCCTTGC Chr16:16863725..16863745 59.87 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCCTTTTGCCGGGAGTAAT Chr16:16864024..16864044 59.8 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000075370