Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13381
Trapped Gene
Kcnip3 (ENSMUSG00000079056)
Vector Insertion
Chr 2: 127291715 - 127307740
Public Clones CMHD-GT_308G05-3 (cmhd) CMHD-GT_309E09-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000641291 (Chr2:127307741..127307843 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGATTCAGGGTATGGAGCTG Chr2:127307820..127307839 59.51 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000641291 (Chr2:127307741..127307843 -)
Downstram Exon
ENSMUSE00000368474 (Chr2:127291590..127291714 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGATTCAGGGTATGGAGCTG Chr2:127307820..127307839 59.51 55 GAAGCCTCGGTAAAGGGACT Chr2:127291574..127291593 59.71 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000318381 Chr2:127346974..127347076 GCAAAGCGGGAAGATTAGTG Chr2:127347011..127347030 59.85 50
upstream ENSMUSE00000661609 Chr2:127346974..127347076 GCAAAGCGGGAAGATTAGTG Chr2:127347011..127347030 59.85 50
upstream ENSMUSE00000683671 Chr2:127338036..127338047 No primer for this exon
upstream ENSMUSE00000318375 Chr2:127336565..127336730 AAGTGGATCCTGTCCAGTGC Chr2:127336582..127336601 60.12 55
upstream ENSMUSE00000641308 Chr2:127336565..127336730 AAGTGGATCCTGTCCAGTGC Chr2:127336582..127336601 60.12 55
upstream ENSMUSE00000641291 Chr2:127307741..127307843 GGATTCAGGGTATGGAGCTG Chr2:127307820..127307839 59.51 55

*** Putative Vector Insertion (Chr 2: 127291715 - 127307740) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000368474 Chr2:127291590..127291714 GAAGCCTCGGTAAAGGGACT Chr2:127291574..127291593 59.71 55
downstream ENSMUSE00000641295 Chr2:127291590..127291710 GAAGCCTCGGTAAAGGGACT Chr2:127291574..127291593 59.71 55
downstream ENSMUSE00000641305 Chr2:127291085..127291154 No primer for this exon
downstream ENSMUSE00000641303 Chr2:127290784..127290854 CATCGAAGGCATTGAAGAGG Chr2:127290791..127290810 60.73 50
downstream ENSMUSE00000641301 Chr2:127286169..127286276 AGATTGAAGGCCCACTTGAG Chr2:127286184..127286203 59.28 50
downstream ENSMUSE00000641299 Chr2:127285719..127285823 AACCTCTCCACATGCTCCAG Chr2:127285704..127285723 60.26 55
downstream ENSMUSE00000641298 Chr2:127285066..127285128 GTCACCACTCCATCCTGGTT Chr2:127285075..127285094 59.82 55
downstream ENSMUSE00000641297 Chr2:127282242..127284124 TGCAGCAGGTTAGAGTGGTG Chr2:127282396..127282415 60.05 55
downstream ENSMUSE00000318331 Chr2:127282235..127284124 TGCAGCAGGTTAGAGTGGTG Chr2:127282396..127282415 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCATGGAAGGTAACATGTGG Chr2:127295728..127295748 58.69 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTAGCCAAGAGCGTGACTG Chr2:127295681..127295701 59.22 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079056