Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13399
Trapped Gene
Pou5f1 (ENSMUSG00000024406)
Vector Insertion
Chr 17: 35643429 - 35646047
Public Clones D081E12 (ggtc) CMHD-GT_314D04-3 (cmhd) CMHD-GT_310B03-3 (cmhd) PST21554-NR (escells)
IST11043C5 (tigm) IST10676C8 (tigm) IST10910B7 (tigm) IST10663H5 (tigm)
IST10976A6 (tigm) IST14606C7 (tigm) IST11041A2 (tigm)
Private Clones OST464107 (lexicon) OST451899 (lexicon) OST450049 (lexicon) OST448948 (lexicon)
OST429855 (lexicon) OST346264 (lexicon) OST319718 (lexicon) OST319634 (lexicon)
OST319577 (lexicon) OST299972 (lexicon) OST289152 (lexicon) OST277773 (lexicon)
OST271280 (lexicon) OST264074 (lexicon) OST256528 (lexicon) OST242986 (lexicon)
OST241726 (lexicon) OST230800 (lexicon) OST198651 (lexicon) OST178953 (lexicon)
OST177057 (lexicon) OST177056 (lexicon) OST172009 (lexicon) OST143173 (lexicon)
OST140527 (lexicon) OST139133 (lexicon) OST137790 (lexicon) OST126556 (lexicon)
OST98174 (lexicon) OST66954 (lexicon)
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000142023 (Chr17:35643007..35643428 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCACGAGTGGAAAGCAACT Chr17:35643329..35643348 60.06 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000142023 (Chr17:35643007..35643428 +)
Downstram Exon
ENSMUSE00000142019 (Chr17:35646048..35646168 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCACGAGTGGAAAGCAACT Chr17:35643329..35643348 60.06 50 CCAAGGTGATCCTCTTCTGC Chr17:35646126..35646145 59.8 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000142023 Chr17:35643007..35643428 AGCACGAGTGGAAAGCAACT Chr17:35643329..35643348 60.06 50

*** Putative Vector Insertion (Chr 17: 35643429 - 35646047) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000142019 Chr17:35646048..35646168 CCAAGGTGATCCTCTTCTGC Chr17:35646126..35646145 59.8 55
downstream ENSMUSE00000142025 Chr17:35646353..35646483 CTCATTGTTGTCGGCTTCCT Chr17:35646474..35646493 60.26 50
downstream ENSMUSE00000142021 Chr17:35646926..35647084 TGATTGGCGATGTGAGTGAT Chr17:35647068..35647087 60.08 45
downstream ENSMUSE00000394011 Chr17:35647233..35647714 TGGGAAAGGTGTCCCTGTAG Chr17:35647337..35647356 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGGAATTTAATCGCCTTGC Chr17:35643472..35643492 60.41 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCAGTGAAGGGAATTCGT Chr17:35643463..35643483 60.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024406