Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13407
Trapped Gene
Cdc37l1 (ENSMUSG00000024780)
Vector Insertion
Chr 19: 29081578 - 29082062
Public Clones CMHD-GT_310B07-3 (cmhd) IST10258F1 (tigm) IST14742C9 (tigm) IST10291F8 (tigm)
IST12514G2 (tigm) IST13091A5 (tigm) IST11087F2 (tigm) IST11532C12 (tigm)
IST10548A12 (tigm) IST11087F2 (tigm) IST14742C9 (tigm) IST11204H9 (tigm)
IST10291F8 (tigm) IST12514G2 (tigm) IST12420C2 (tigm) IST13091A5 (tigm)
Private Clones OST44745 (lexicon)
Severity of mutation (?) Insertion after 62% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000144922 (Chr19:29081462..29081577 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCACCCACACCTCGTATGT Chr19:29081504..29081523 60.16 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000144922 (Chr19:29081462..29081577 +)
Downstram Exon
ENSMUSE00000144918 (Chr19:29082063..29082185 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCACCCACACCTCGTATGT Chr19:29081504..29081523 60.16 55 TGTTCCATTAGAGCGCCTTT Chr19:29082085..29082104 59.85 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000408401 Chr19:29064984..29065159 CGTCCCACTACTCTCCGGTA Chr19:29065122..29065141 60.13 60
upstream ENSMUSE00000144925 Chr19:29069531..29069812 GGAACATGGATGCCATTAGC Chr19:29069775..29069794 60.3 50
upstream ENSMUSE00000144926 Chr19:29073751..29073841 No primer for this exon
upstream ENSMUSE00000144922 Chr19:29081462..29081577 ACCACCCACACCTCGTATGT Chr19:29081504..29081523 60.16 55

*** Putative Vector Insertion (Chr 19: 29081578 - 29082062) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000144918 Chr19:29082063..29082185 TGTTCCATTAGAGCGCCTTT Chr19:29082085..29082104 59.85 45
downstream ENSMUSE00000489299 Chr19:29086379..29086543 CAGAATGGGGGACATGATTC Chr19:29086508..29086527 60.13 50
downstream ENSMUSE00000444339 Chr19:29090496..29092059 GTAGGTCACCACTGCGGATT Chr19:29091097..29091116 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGTTTCCACCTAGAAGCTG Chr19:29081553..29081574 58.85 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTCGTGACTGGGAAAACC Chr19:29081625..29081645 59.95 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024780