Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13411
Trapped Gene
Polr3g (ENSMUSG00000035834)
Vector Insertion
Chr 13: 81828256 - 81833646
Public Clones CMHD-GT_310D04-3 (cmhd) CMHD-GT_505H4-3 (cmhd)
Private Clones OST460886 (lexicon) OST385959 (lexicon) OST64808 (lexicon) OST62494 (lexicon)
OST62492 (lexicon)
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000461631 (Chr13:81833647..81833776 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAACCACCCGAAGAAAAAC Chr13:81833650..81833669 59.95 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000461631 (Chr13:81833647..81833776 -)
Downstram Exon
ENSMUSE00000248747 (Chr13:81828196..81828255 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAACCACCCGAAGAAAAAC Chr13:81833650..81833669 59.95 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000411101 Chr13:81849857..81850012 GTAGAATCTGCGGCTCCTTG Chr13:81849928..81849947 59.98 55
upstream ENSMUSE00000411409 Chr13:81838743..81838892 AATGGCTGGCAATAAAGGAA Chr13:81838841..81838860 59.55 40
upstream ENSMUSE00000461631 Chr13:81833647..81833776 TGAACCACCCGAAGAAAAAC Chr13:81833650..81833669 59.95 45

*** Putative Vector Insertion (Chr 13: 81828256 - 81833646) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000248747 Chr13:81828196..81828255 No primer for this exon
downstream ENSMUSE00000248738 Chr13:81826125..81826175 TTGGCATCATCTCTCTTGGA Chr13:81826121..81826140 59.32 45
downstream ENSMUSE00000248728 Chr13:81821111..81821193 No primer for this exon
downstream ENSMUSE00000248719 Chr13:81817115..81817258 GATCTTTCACCCTCGCCTCT Chr13:81817205..81817224 60.74 55
downstream ENSMUSE00000374931 Chr13:81812836..81815121 TGGATGTAAGCGTTCAGCAG Chr13:81813474..81813493 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCACATAATCGCCTTGCAG Chr13:81833581..81833601 59.83 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACACGTGACTGGGAAAAC Chr13:81833580..81833600 59.57 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035834