Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13416
Trapped Gene
Lgals9 (ENSMUSG00000001123)
Vector Insertion
Chr 11: 78790204 - 78798279
Public Clones CMHD-GT_488F4-3 (cmhd) CMHD-GT_314G04-3 (cmhd) IST13676D3 (tigm) IST10900E7 (tigm)
IST15031B11 (tigm) IST14563B5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000489086 (Chr11:78798280..78798333 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000489086 (Chr11:78798280..78798333 -)
Downstram Exon
ENSMUSE00000109688 (Chr11:78790115..78790203 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000489086 Chr11:78798280..78798333 No primer for this exon
upstream ENSMUSE00000676171 Chr11:78798280..78798353 No primer for this exon

*** Putative Vector Insertion (Chr 11: 78790204 - 78798279) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000109688 Chr11:78790115..78790203 No primer for this exon
downstream ENSMUSE00000109693 Chr11:78786490..78786691 No primer for this exon
downstream ENSMUSE00000281934 Chr11:78784819..78784929 No primer for this exon
downstream ENSMUSE00000513621 Chr11:78783216..78783308 No primer for this exon
downstream ENSMUSE00000676168 Chr11:78783216..78783305 No primer for this exon
downstream ENSMUSE00000281922 Chr11:78781500..78781535 No primer for this exon
downstream ENSMUSE00000109691 Chr11:78780946..78780996 No primer for this exon
downstream ENSMUSE00000109686 Chr11:78780379..78780420 No primer for this exon
downstream ENSMUSE00000109683 Chr11:78779500..78779588 No primer for this exon
downstream ENSMUSE00000109681 Chr11:78779194..78779356 No primer for this exon
downstream ENSMUSE00000510955 Chr11:78776897..78777043 No primer for this exon
downstream ENSMUSE00000676170 Chr11:78776485..78777043 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTATAATCGCCTTGCAGCAC Chr11:78792211..78792232 60.24 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTCGGTGTTTCCAAATTC Chr11:78792285..78792305 60.73 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGGTCCTTCCCCATCTTTTT Chr11:78792289..78792309 58.9 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGGTCCTTCCCCATCTTTTT Chr11:78792289..78792309 58.9 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001123