Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13419
Trapped Gene
Prr6 (ENSMUSG00000018509)
Vector Insertion
Chr 11: 62349883 - 62352357
Public Clones (sanger) CMHD-GT_318G07-3 (cmhd) IST13102C6 (tigm) IST10066G9 (tigm)
IST13009A3 (tigm) IST11090F1 (tigm) IST10158B9 (tigm) IST10460F6 (tigm)
IST14492G2 (tigm) IST14506C3 (tigm) IST13009A3 (tigm) IST11533D10 (tigm)
IST11678H12HMF1 (tigm) IST12383F12 (tigm) IST11007D6 (tigm) IST11090F1 (tigm)
Private Clones OST433180 (lexicon) OST391853 (lexicon) OST369905 (lexicon) OST333295 (lexicon)
OST305148 (lexicon) OST106854 (lexicon) OST96648 (lexicon) OST44511 (lexicon)
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000335488 (Chr11:62352358..62352763 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000335488 (Chr11:62352358..62352763 -)
Downstram Exon
ENSMUSE00000106582 (Chr11:62349784..62349882 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000335488 Chr11:62352358..62352763 No primer for this exon

*** Putative Vector Insertion (Chr 11: 62349883 - 62352357) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000106582 Chr11:62349784..62349882 No primer for this exon
downstream ENSMUSE00000106583 Chr11:62347387..62347456 No primer for this exon
downstream ENSMUSE00000106584 Chr11:62340994..62341108 No primer for this exon
downstream ENSMUSE00000106587 Chr11:62338448..62338789 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTGGACACCTTGTGAGTG Chr11:62352349..62352369 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTGGACACCTTGTGAGTG Chr11:62352349..62352369 60.94 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GATAATCGCCTTGCAGCACA Chr11:62352695..62352715 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCTTTGACTGCAAGCGTGAC Chr11:62352775..62352795 60.18 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018509