Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13436
Trapped Gene
Naca (ENSMUSG00000061315)
Vector Insertion
Chr 10: 127482143 - 127483223
Public Clones CMHD-GT_308D08-3 (cmhd) CMHD-GT_411E2-3 (cmhd)
Private Clones OST392741 (lexicon) OST293489 (lexicon) OST175625 (lexicon) OST68488 (lexicon)
OST42987 (lexicon)
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000573195 (Chr10:127476227..127482142 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGCAACTCCCAAAGAGAC Chr10:127478794..127478813 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000573195 (Chr10:127476227..127482142 +)
Downstram Exon
ENSMUSE00000481992 (Chr10:127483224..127483309 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGCAACTCCCAAAGAGAC Chr10:127478794..127478813 60 55 CTTGTTCCTCGAGCTCTGGT Chr10:127483280..127483299 59.6 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000485964 Chr10:127472701..127472739 ATCTTGGTTCCGTGATCTCC Chr10:127472715..127472734 58.94 50
upstream ENSMUSE00000273294 Chr10:127473545..127473616 ACAGAAACCGTCCCTGCTAC Chr10:127473562..127473581 59.21 55
upstream ENSMUSE00000573195 Chr10:127476227..127482142 GCTGCAACTCCCAAAGAGAC Chr10:127478794..127478813 60 55

*** Putative Vector Insertion (Chr 10: 127482143 - 127483223) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000481992 Chr10:127483224..127483309 CTTGTTCCTCGAGCTCTGGT Chr10:127483280..127483299 59.6 55
downstream ENSMUSE00000476151 Chr10:127483785..127483862 CTTCGACTCTGCTTGGCTTT Chr10:127483846..127483865 59.76 50
downstream ENSMUSE00000477920 Chr10:127484714..127484860 CCCCTGTAACCTGTCGAAGA Chr10:127484753..127484772 60.1 55
downstream ENSMUSE00000505712 Chr10:127485055..127485183 ACTCTCCTCTTGGACGGTTG Chr10:127485174..127485193 59.3 55
downstream ENSMUSE00000509865 Chr10:127485301..127485423 ACTTCCACACCCGTCTCATC Chr10:127485326..127485345 59.97 55
downstream ENSMUSE00000335588 Chr10:127485549..127485688 GAAAGGGGGAGTTGTCTTCG Chr10:127485597..127485616 60.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCCACACCCCTCTTTAATC Chr10:127482179..127482199 60.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000061315