Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13439
Trapped Gene
Cplx3 (ENSMUSG00000039714)
Vector Insertion
Chr 9: 57450269 - 57452523
Public Clones CMHD-GT_314A07-3 (cmhd) CMHD-GT_132E10-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 53% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000258625 (Chr9:57452524..57452611 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAAATACCGTCTGCCCAAG Chr9:57452524..57452543 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000258625 (Chr9:57452524..57452611 -)
Downstram Exon
ENSMUSE00000377015 (Chr9:57449183..57450268 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAAATACCGTCTGCCCAAG Chr9:57452524..57452543 59.99 50 GGCTTTGTCCTTGAGTGAGC Chr9:57450076..57450095 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000258649 Chr9:57453788..57454038 GAAAAGACCATGGCGTTCAT Chr9:57453941..57453960 59.94 45
upstream ENSMUSE00000258625 Chr9:57452524..57452611 ACAAATACCGTCTGCCCAAG Chr9:57452524..57452543 59.99 50

*** Putative Vector Insertion (Chr 9: 57450269 - 57452523) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000377015 Chr9:57449183..57450268 GGCTTTGTCCTTGAGTGAGC Chr9:57450076..57450095 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000039714