Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13451
Trapped Gene
Slc25a43 (ENSMUSG00000037636)
Vector Insertion
Chr X: 34297936 - 34315476
Public Clones CMHD-GT_312D04-3 (cmhd) IST10211C7 (tigm) IST14891D10 (tigm) IST11400E12 (tigm)
IST10153G10 (tigm) IST12278B2HMF1 (tigm) IST13288E1 (tigm) IST10362G5 (tigm)
IST12021H6 (tigm) IST14459G2 (tigm) IST13187H8 (tigm) IST12278B2BBF1 (tigm)
IST10362G5 (tigm) IST10458A6 (tigm) IST11627A10 (tigm) IST10153G10 (tigm)
IST10211C7 (tigm)
Private Clones OST470875 (lexicon) OST459196 (lexicon) OST407735 (lexicon) OST398519 (lexicon)
OST381398 (lexicon) OST354033 (lexicon) OST346155 (lexicon) OST338331 (lexicon)
OST290870 (lexicon) OST285916 (lexicon) OST283699 (lexicon) OST276700 (lexicon)
OST207658 (lexicon) OST176741 (lexicon) OST170873 (lexicon) OST153974 (lexicon)
OST150303 (lexicon) OST120882 (lexicon) OST120864 (lexicon) OST120846 (lexicon)
OST120828 (lexicon) OST120824 (lexicon) OST116080 (lexicon) OST106820 (lexicon)
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000359857 (ChrX:34297763..34297935 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTTGCCAATGTCTGTGTGG ChrX:34297857..34297876 60.15 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000359857 (ChrX:34297763..34297935 +)
Downstram Exon
ENSMUSE00000394777 (ChrX:34315477..34315611 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTTGCCAATGTCTGTGTGG ChrX:34297857..34297876 60.15 50 CCAGTACCCCTTGGGTTTTC ChrX:34315579..34315598 60.58 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000355343 ChrX:34283706..34284013 GTCAGGATGGCTACGTGGAG ChrX:34283733..34283752 60.68 60
upstream ENSMUSE00000316538 ChrX:34292128..34292369 GCCCTTTATCGAGGGGTATC ChrX:34292336..34292355 59.76 55
upstream ENSMUSE00000359857 ChrX:34297763..34297935 CTTTGCCAATGTCTGTGTGG ChrX:34297857..34297876 60.15 50

*** Putative Vector Insertion (Chr X: 34297936 - 34315476) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000394777 ChrX:34315477..34315611 CCAGTACCCCTTGGGTTTTC ChrX:34315579..34315598 60.58 55
downstream ENSMUSE00000370867 ChrX:34316997..34317197 GTGCAGTTTTCTGCGTTTGA ChrX:34317179..34317198 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGCTGCTGTGTGAGTCTT ChrX:34309935..34309955 59.37 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGCTGCTGTGTGAGTCTT ChrX:34309935..34309955 59.37 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037636