Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13463
Trapped Gene
Jam2 (ENSMUSG00000053062)
Vector Insertion
Chr 16: 84819021 - 84821504
Public Clones CMHD-GT_247D06-3 (cmhd)
Private Clones OST321787 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000698469 (Chr16:84819005..84819020 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000698469 (Chr16:84819005..84819020 +)
Downstram Exon
ENSMUSE00000131670 (Chr16:84821505..84821547 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698472 Chr16:84774368..84774798 GTCCTAGGGCCAGAAGACCT Chr16:84774523..84774542 59.7 60
upstream ENSMUSE00000465097 Chr16:84774528..84774798 GACTGACATCGGGACAGGAC Chr16:84774582..84774601 60.54 60
upstream ENSMUSE00000698466 Chr16:84774631..84774798 GATGCTGCTGCTGCTACACT Chr16:84774758..84774777 59.37 55
upstream ENSMUSE00000268247 Chr16:84801815..84801883 CATCAAAAGACCACCGTCAA Chr16:84801839..84801858 59.54 45
upstream ENSMUSE00000268240 Chr16:84807080..84807187 TGGCTTGTAAAACCCCAAAG Chr16:84807089..84807108 59.97 45
upstream ENSMUSE00000496500 Chr16:84809589..84809741 GCTGGAGAGTATCGCTGTGA Chr16:84809657..84809676 59.14 55
upstream ENSMUSE00000634408 Chr16:84809589..84811241 GACTTCCATTCGCATTCCAT Chr16:84810136..84810155 59.9 45
upstream ENSMUSE00000131665 Chr16:84813144..84813343 ATGGCACAAGTTTGCTAGGG Chr16:84813261..84813280 60.13 50
upstream ENSMUSE00000131671 Chr16:84815414..84815513 TCCAAGATGGACAGTGGAGA Chr16:84815429..84815448 59.18 50
upstream ENSMUSE00000131673 Chr16:84816511..84816618 ATAGCAACGGTTGTGGTGGT Chr16:84816534..84816553 60.3 50
upstream ENSMUSE00000698469 Chr16:84819005..84819020 No primer for this exon

*** Putative Vector Insertion (Chr 16: 84819021 - 84821504) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000131670 Chr16:84821505..84821547 No primer for this exon
downstream ENSMUSE00000404528 Chr16:84823032..84823128 TTTGGTGCAGCTCAAAACTG Chr16:84823095..84823114 60.03 45
downstream ENSMUSE00000698468 Chr16:84823032..84826173 TTTGGTGCAGCTCAAAACTG Chr16:84823095..84823114 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTTTAATCGCCTTGCAGCAC Chr16:84819068..84819089 62.43 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTCGTGACTGGGAAAACC Chr16:84819068..84819088 59.95 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053062