Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13465
Trapped Gene
Plekhc1 (ENSMUSG00000037712)
Vector Insertion
Chr 14: 46079699 - 46081441
Public Clones CMHD-GT_247D05-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000314950 (Chr14:46081442..46081583 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACAGGTTGATTCGGATGGA Chr14:46081521..46081540 60.32 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000314950 (Chr14:46081442..46081583 -)
Downstram Exon
ENSMUSE00000706596 (Chr14:46079428..46079698 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACAGGTTGATTCGGATGGA Chr14:46081521..46081540 60.32 45 ATTTTGGTCTTTCGCACGAG Chr14:46079554..46079573 60.25 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000453533 Chr14:46149611..46149713 No primer for this exon
upstream ENSMUSE00000706602 Chr14:46149609..46149793 No primer for this exon
upstream ENSMUSE00000408319 Chr14:46149100..46149266 GCTCTGGACGGGATAAGGAT Chr14:46149234..46149253 60.43 55
upstream ENSMUSE00000722177 Chr14:46149100..46149266 GCTCTGGACGGGATAAGGAT Chr14:46149234..46149253 60.43 55
upstream ENSMUSE00000315015 Chr14:46124172..46124405 TGGATAAGTGTGGCATCCAG Chr14:46124308..46124327 59.52 50
upstream ENSMUSE00000314890 Chr14:46102107..46102241 CCCAGAGATCCCACAAAGAA Chr14:46102184..46102203 60.04 50
upstream ENSMUSE00000314881 Chr14:46095563..46095788 ACCAACTTCTGCCTGGTTTG Chr14:46095690..46095709 60.15 50
upstream ENSMUSE00000315007 Chr14:46095248..46095350 TTGCTGCTCCGATTCAAGTA Chr14:46095276..46095295 59.57 45
upstream ENSMUSE00000314872 Chr14:46092447..46092554 AGAGATCGAATGCACGGAAG Chr14:46092476..46092495 60.36 50
upstream ENSMUSE00000314864 Chr14:46088915..46089049 GCCCTTTCTGACCTGGAGAT Chr14:46088949..46088968 60.6 55
upstream ENSMUSE00000314991 Chr14:46088178..46088227 TCAATCCCAGAACTTGCTGA Chr14:46088196..46088215 59.37 45
upstream ENSMUSE00000314985 Chr14:46087013..46087137 AGACACGTCCATCTCCTGCT Chr14:46087067..46087086 59.87 55
upstream ENSMUSE00000314978 Chr14:46084759..46084865 ATGAGATCTGGCTTCGCTGT Chr14:46084765..46084784 59.98 50
upstream ENSMUSE00000314969 Chr14:46084399..46084620 TGATCCCTGACCAGATCACA Chr14:46084462..46084481 60.05 50
upstream ENSMUSE00000314959 Chr14:46081791..46081915 TAGCCCAGATGAGCCTGATT Chr14:46081862..46081881 59.8 50
upstream ENSMUSE00000314950 Chr14:46081442..46081583 AACAGGTTGATTCGGATGGA Chr14:46081521..46081540 60.32 45

*** Putative Vector Insertion (Chr 14: 46079699 - 46081441) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000706596 Chr14:46079428..46079698 ATTTTGGTCTTTCGCACGAG Chr14:46079554..46079573 60.25 45
downstream ENSMUSE00000336558 Chr14:46078467..46079698 ATTTTGGTCTTTCGCACGAG Chr14:46079554..46079573 60.25 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAGCAACATGAAGCAGTGG Chr14:46081464..46081484 61.02 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCAACATGAAGCAGTGGAA Chr14:46081462..46081482 59.44 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037712