Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1349
Trapped Gene
Mcm7 (ENSMUSG00000029730)
Vector Insertion
Chr 5: 138611625 - 138612953
Public Clones (sanger) CJ0572 (sanger) (sanger) AQ0003 (sanger) (sanger)
YTA287 (baygenomics) YTA285 (baygenomics) XG063 (baygenomics) E054C07 (ggtc)
D045E01 (ggtc) D039F10 (ggtc) M066C03 (ggtc) D045D01 (ggtc) D039F10 (ggtc)
D045D01 (ggtc) P033A04 (ggtc) PST2547-NR (escells) IST14666B7 (tigm)
IST15005A3 (tigm)
Private Clones OST302023 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000686007 (Chr5:138612954..138613090 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATGGCGCTTAAGGACTACG Chr5:138612966..138612985 59.87 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000686007 (Chr5:138612954..138613090 -)
Downstram Exon
ENSMUSE00000304321 (Chr5:138611545..138611624 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATGGCGCTTAAGGACTACG Chr5:138612966..138612985 59.87 55 CAACTGGGTCCCATACTTGAA Chr5:138611523..138611543 59.84 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000686007 Chr5:138612954..138613090 GATGGCGCTTAAGGACTACG Chr5:138612966..138612985 59.87 55

*** Putative Vector Insertion (Chr 5: 138611625 - 138612953) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000304321 Chr5:138611545..138611624 CAACTGGGTCCCATACTTGAA Chr5:138611523..138611543 59.84 47.62
downstream ENSMUSE00000192143 Chr5:138610788..138610952 GTCGACCAACTCAGGGTCAT Chr5:138610850..138610869 59.97 55
downstream ENSMUSE00000192142 Chr5:138610577..138610701 TCAGCCGGTGTTCAATGTAA Chr5:138610634..138610653 60.11 45
downstream ENSMUSE00000192155 Chr5:138610326..138610506 GGCCTCGGAAATACAACTCA Chr5:138610465..138610484 60.07 50
downstream ENSMUSE00000304275 Chr5:138610038..138610175 AACAAATTTGGAGCCACGAG Chr5:138610046..138610065 60.11 45
downstream ENSMUSE00000192141 Chr5:138609561..138609710 GCTGGGCAATTCTTGTGTTC Chr5:138609610..138609629 60.65 50
downstream ENSMUSE00000192152 Chr5:138609286..138609400 CAGTGGGCTTCCAGGTAAGT Chr5:138609344..138609363 59.21 55
downstream ENSMUSE00000192150 Chr5:138609069..138609200 AGGAGACTGGTCCACACCAC Chr5:138609066..138609085 60.01 60
downstream ENSMUSE00000192151 Chr5:138608779..138608862 CACACCAGGGTCTCCCATAA Chr5:138608803..138608822 60.77 55
downstream ENSMUSE00000192145 Chr5:138608274..138608667 ATTGAGCGTGGTGAGAATCC Chr5:138608410..138608429 60.08 50
downstream ENSMUSE00000192147 Chr5:138607911..138607994 GTGCTGGTGGACATAGGTGA Chr5:138607939..138607958 59.55 55
downstream ENSMUSE00000192148 Chr5:138607138..138607306 TCCGGGCAGAAGTATAGGTG Chr5:138607151..138607170 60.09 55
downstream ENSMUSE00000192153 Chr5:138606280..138606389 TCCTTCGACATCTCCATCAA Chr5:138606291..138606310 59.17 45
downstream ENSMUSE00000535291 Chr5:138605817..138606148 TGAAGCCACGAGATATGCAG Chr5:138606017..138606036 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTTCTGCTAATCGCCTTGC Chr5:138613028..138613048 60.48 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000029730