Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13493
Trapped Gene
Ccnb3 (ENSMUSG00000051592)
Vector Insertion
Chr X: 6582474 - 6584137
Public Clones CMHD-GT_281B06-3 (cmhd) IST14869D1 (tigm) IST14522F10 (tigm) IST11512A4 (tigm)
IST13719B10 (tigm) IST13533C5 (tigm) IST13191F11 (tigm) IST14601E9 (tigm)
IST12482F10 (tigm) IST11430B3 (tigm) IST10886H6 (tigm) IST11430D8 (tigm)
IST11640B4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000338429 (ChrX:6584138..6586846 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGAGAAAGATCCCCCTTCC ChrX:6586013..6586032 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000338429 (ChrX:6584138..6586846 -)
Downstram Exon
ENSMUSE00000331524 (ChrX:6582360..6582473 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGAGAAAGATCCCCCTTCC ChrX:6586013..6586032 60.01 55 ATGGATCTTGGCCTTCCTTT ChrX:6582391..6582410 59.9 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000704045 ChrX:6618696..6618745 GCTGAGGCCGTTATGCTAAG ChrX:6618703..6618722 60 55
upstream ENSMUSE00000704044 ChrX:6615855..6615895 No primer for this exon
upstream ENSMUSE00000443291 ChrX:6607917..6608062 CTGCATAAAGATGCCACCAC ChrX:6608003..6608022 59.15 50
upstream ENSMUSE00000704043 ChrX:6607917..6608050 CTGCATAAAGATGCCACCAC ChrX:6608003..6608022 59.15 50
upstream ENSMUSE00000369694 ChrX:6602729..6602818 CTCAAGGCGCAGTAAAGAGG ChrX:6602756..6602775 60.15 55
upstream ENSMUSE00000371407 ChrX:6597148..6597260 AAGCCATGTTTCCAAAAGGA ChrX:6597191..6597210 59.55 40
upstream ENSMUSE00000406199 ChrX:6586944..6587262 TGGGGCATGTTACTTCACTG ChrX:6587235..6587254 59.57 50
upstream ENSMUSE00000338429 ChrX:6584138..6586846 CTGAGAAAGATCCCCCTTCC ChrX:6586013..6586032 60.01 55

*** Putative Vector Insertion (Chr X: 6582474 - 6584137) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000331524 ChrX:6582360..6582473 ATGGATCTTGGCCTTCCTTT ChrX:6582391..6582410 59.9 45
downstream ENSMUSE00000443281 ChrX:6572637..6572729 ATCTCCACCAACCAGTCCAC ChrX:6572619..6572638 59.82 55
downstream ENSMUSE00000247155 ChrX:6567525..6567662 CAGGGTCTCATGGGTCATCT ChrX:6567611..6567630 59.92 55
downstream ENSMUSE00000247151 ChrX:6563396..6563551 GGATGCTGCTTTCCAAAGAT ChrX:6563439..6563458 59.27 45
downstream ENSMUSE00000247142 ChrX:6562542..6562691 AGGCTGCAGCTAGCTTTGAA ChrX:6562561..6562580 60.43 50
downstream ENSMUSE00000247134 ChrX:6557377..6557507 ATCGGAAGTTCAGCAAATGG ChrX:6557398..6557417 60.07 45
downstream ENSMUSE00000512966 ChrX:6556778..6557093 TGCTCAAAGGAGGGATTTTG ChrX:6557034..6557053 60.18 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTGCAAAAGAAACTGAGG ChrX:6584135..6584155 59.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTGCAAAAGAAACTGAGG ChrX:6584135..6584155 59.71 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCTCAATAATCGCCTTGCAG ChrX:6586782..6586802 60.73 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACCTCAACGTGACTGGGAAA ChrX:6583783..6583803 60.54 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051592