Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13494
Trapped Gene
Zdhhc24 (ENSMUSG00000006463)
Vector Insertion
Chr 19: 4880399 - 4883475
Public Clones CMHD-GT_276F12-3 (cmhd) CMHD-GT_276F8-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000146111 (Chr19:4880121..4880398 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000146111 (Chr19:4880121..4880398 +)
Downstram Exon
ENSMUSE00000445092 (Chr19:4883476..4885390 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000366031 Chr19:4878685..4879029 No primer for this exon
upstream ENSMUSE00000146111 Chr19:4880121..4880398 No primer for this exon

*** Putative Vector Insertion (Chr 19: 4880399 - 4883475) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000445092 Chr19:4883476..4885390 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTACAGGATGGAGGCTTTGG Chr19:4883378..4883398 60.07 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGCCAGCCAACTGCTATT Chr19:4883426..4883446 61.14 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006463