Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1350
Trapped Gene
Ctbp1 (ENSMUSG00000037373)
Vector Insertion
Chr 5: 33609687 - 33617427
Public Clones CJ0571 (sanger) IST14632A8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000401517 (Chr5:33617428..33617610 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCTCCCACTTGCTCAACA Chr5:33617443..33617462 62.55 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000401517 (Chr5:33617428..33617610 -)
Downstram Exon
ENSMUSE00000245992 (Chr5:33609532..33609686 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCTCCCACTTGCTCAACA Chr5:33617443..33617462 62.55 55 TCATGGATCTCCTGTGTGGA Chr5:33609514..33609533 60.05 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000401517 Chr5:33617428..33617610 CAGCTCCCACTTGCTCAACA Chr5:33617443..33617462 62.55 55

*** Putative Vector Insertion (Chr 5: 33609687 - 33617427) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000245992 Chr5:33609532..33609686 TCATGGATCTCCTGTGTGGA Chr5:33609514..33609533 60.05 50
downstream ENSMUSE00000548492 Chr5:33603658..33603802 CCAATTCGGACGATGATTCT Chr5:33603680..33603699 59.89 45
downstream ENSMUSE00000245962 Chr5:33601787..33601993 GTGGTTCGTCGGTACAGGTT Chr5:33601881..33601900 59.89 55
downstream ENSMUSE00000548489 Chr5:33593507..33593721 AAGAGGACGTTGAAGCCAAA Chr5:33593642..33593661 59.85 45
downstream ENSMUSE00000548486 Chr5:33593020..33593150 AGTGCCTTCTCATCCACCAG Chr5:33593067..33593086 60.26 55
downstream ENSMUSE00000548483 Chr5:33592236..33592363 CCTTTAAGGGTCCCTGGCTA Chr5:33592319..33592338 60.44 55
downstream ENSMUSE00000245917 Chr5:33591756..33591873 AGGTGGTCCTTGTTGACACA Chr5:33591806..33591825 58.99 50
downstream ENSMUSE00000519742 Chr5:33590403..33591335 TTAAACGAGGAACGCAAAGG Chr5:33590908..33590927 60.24 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCCTTTGAGGGCTTTAATCG Chr5:33617370..33617391 60.08 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGTCCGTGACTGGGAAAAC Chr5:33617361..33617381 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TATAATCGCCTTGCAGCACA Chr5:33614542..33614562 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCATTTCGTGACTGGGAAAA Chr5:33614546..33614566 60.86 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037373