Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13503
Trapped Gene
Cacng7 (ENSMUSG00000069806)
Vector Insertion
Chr 7: 3365682 - 3366279
Public Clones (sanger) 3SD159B05 (ggtc) (ggtc) (ggtc) (cmhd) CMHD-GT_378E12-3 (cmhd)
CMHD-GT_302B6-3 (cmhd) CMHD-GT_462A9-3 (cmhd) PST514 (escells) IST14228C8 (tigm)
IST14970F7 (tigm) IST10948F8 (tigm) IST13302E4 (tigm) IST10881D3 (tigm)
IST10099H8 (tigm) IST12380A10 (tigm)
Private Clones OST434470 (lexicon) OST420181 (lexicon) OST318190 (lexicon) OST174294 (lexicon)
OST62643 (lexicon)
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000578335 (Chr7:3365536..3365681 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACTATCGCTACGGGTGGTC Chr7:3365625..3365644 60.54 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000578335 (Chr7:3365536..3365681 +)
Downstram Exon
ENSMUSE00000578334 (Chr7:3366280..3367810 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACTATCGCTACGGGTGGTC Chr7:3365625..3365644 60.54 60 GAGATGGTCCGGGTACTTGA Chr7:3366516..3366535 59.93 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677469 Chr7:3333055..3333136 No primer for this exon
upstream ENSMUSE00000677467 Chr7:3336656..3336880 AGACCACCGAGGTCAAGATG Chr7:3336821..3336840 60.11 55
upstream ENSMUSE00000677466 Chr7:3338545..3338631 CAACTTGGTGACGGAAAACA Chr7:3338597..3338616 59.58 45
upstream ENSMUSE00000677465 Chr7:3338986..3339126 ACCATTCTTGCGTTCGTTTC Chr7:3339084..3339103 60.12 45
upstream ENSMUSE00000578335 Chr7:3365536..3365681 CACTATCGCTACGGGTGGTC Chr7:3365625..3365644 60.54 60

*** Putative Vector Insertion (Chr 7: 3365682 - 3366279) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000578334 Chr7:3366280..3367810 GAGATGGTCCGGGTACTTGA Chr7:3366516..3366535 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCGCTGCTTCCTCTTTTCT Chr7:3365653..3365673 59.34 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCGCTGCTTCCTCTTTTCT Chr7:3365653..3365673 59.34 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069806