Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13511
Trapped Gene
Glod5 (ENSMUSG00000031163)
Vector Insertion
Chr X: 7592482 - 7595542
Public Clones CMHD-GT_303B7-3 (cmhd) CMHD-GT_111.1G4-5S (cmhd) IST14233F2 (tigm)
IST13168E1 (tigm)
Private Clones OST356860 (lexicon) OST253339 (lexicon) OST170134 (lexicon) OST57898 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000206988 (ChrX:7595543..7595618 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCCTTCCAGTCTACCAGGA ChrX:7595573..7595592 60.79 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000206988 (ChrX:7595543..7595618 -)
Downstram Exon
ENSMUSE00000206987 (ChrX:7592344..7592481 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCCTTCCAGTCTACCAGGA ChrX:7595573..7595592 60.79 55 CAGATAAGACACGGGGAAGG ChrX:7592416..7592435 59.54 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000206988 ChrX:7595543..7595618 TGCCTTCCAGTCTACCAGGA ChrX:7595573..7595592 60.79 55

*** Putative Vector Insertion (Chr X: 7592482 - 7595542) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000206987 ChrX:7592344..7592481 CAGATAAGACACGGGGAAGG ChrX:7592416..7592435 59.54 55
downstream ENSMUSE00000206984 ChrX:7582829..7582984 ACACAATGCTTTCCGGTTTC ChrX:7582942..7582961 59.98 45
downstream ENSMUSE00000240769 ChrX:7581327..7581628 TGTCCGGATCTCGGAAGTAG ChrX:7581519..7581538 60.21 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAATTTGGCTTTTTCCGAGT ChrX:7595537..7595557 59.2 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAATTTGGCTTTTTCCGAGT ChrX:7595537..7595557 59.2 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GAAGGAGTTTTCCCCTTGGA ChrX:7595630..7595650 60.41 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAAGGAGTTTTCCCCTTGGA ChrX:7592630..7592650 60.41 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031163