Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13516
Trapped Gene
Mov10 (ENSMUSG00000002227)
Vector Insertion
Chr 3: 104608026 - 104620853
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) E066C08 (ggtc)
D187E05 (ggtc) (ggtc) E066C08 (ggtc) (ggtc) D175G05 (ggtc) E066C05 (ggtc)
(ggtc) CMHD-GT_404G2-3 (cmhd) (cmhd) CMHD-GT_303A7-3 (cmhd) CMHD-GT_429A1-3 (cmhd)
CMHD-GT_476B3-3 (cmhd) IST10886G4 (tigm) IST10502E1 (tigm) IST11972A8 (tigm)
IST14865A3 (tigm) IST10368E7 (tigm) IST12892H8 (tigm) IST12479G3 (tigm)
IST12276E7 (tigm) IST12265G9 (tigm) IST12710F5 (tigm) IST12786C10 (tigm)
IST11775E7 (tigm) IST14168G10 (tigm) IST12786B9 (tigm) IST11398F11 (tigm)
IST10878E4 (tigm) IST10030G7 (tigm)
Private Clones OST284197 (lexicon) OST243889 (lexicon) OST242766 (lexicon) OST232324 (lexicon)
OST202223 (lexicon) OST66125 (lexicon) OST56890 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000671113 (Chr3:104620854..104621039 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000671113 (Chr3:104620854..104621039 -)
Downstram Exon
ENSMUSE00000173475 (Chr3:104607822..104608025 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000671114 Chr3:104621275..104621481 No primer for this exon
upstream ENSMUSE00000671112 Chr3:104621176..104621481 No primer for this exon
upstream ENSMUSE00000336505 Chr3:104620854..104621160 No primer for this exon
upstream ENSMUSE00000671111 Chr3:104620854..104621074 No primer for this exon
upstream ENSMUSE00000671113 Chr3:104620854..104621039 No primer for this exon
upstream ENSMUSE00000714749 Chr3:104620854..104621160 No primer for this exon

*** Putative Vector Insertion (Chr 3: 104608026 - 104620853) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000173475 Chr3:104607822..104608025 No primer for this exon
downstream ENSMUSE00000671146 Chr3:104607396..104607631 No primer for this exon
downstream ENSMUSE00000173474 Chr3:104607389..104607631 No primer for this exon
downstream ENSMUSE00000173473 Chr3:104607049..104607303 No primer for this exon
downstream ENSMUSE00000671143 Chr3:104607049..104607310 No primer for this exon
downstream ENSMUSE00000173482 Chr3:104605711..104605845 No primer for this exon
downstream ENSMUSE00000173486 Chr3:104605344..104605512 No primer for this exon
downstream ENSMUSE00000173485 Chr3:104604316..104604470 No primer for this exon
downstream ENSMUSE00000173480 Chr3:104603875..104604051 No primer for this exon
downstream ENSMUSE00000173487 Chr3:104603605..104603752 No primer for this exon
downstream ENSMUSE00000173490 Chr3:104603193..104603351 No primer for this exon
downstream ENSMUSE00000173481 Chr3:104602864..104602967 No primer for this exon
downstream ENSMUSE00000173483 Chr3:104602616..104602713 No primer for this exon
downstream ENSMUSE00000173489 Chr3:104602310..104602526 No primer for this exon
downstream ENSMUSE00000173488 Chr3:104600193..104600310 No primer for this exon
downstream ENSMUSE00000173477 Chr3:104599888..104600079 No primer for this exon
downstream ENSMUSE00000173478 Chr3:104599685..104599759 No primer for this exon
downstream ENSMUSE00000173479 Chr3:104598778..104598903 No primer for this exon
downstream ENSMUSE00000173472 Chr3:104598612..104598700 No primer for this exon
downstream ENSMUSE00000314720 Chr3:104598243..104598364 No primer for this exon
downstream ENSMUSE00000569816 Chr3:104597754..104598158 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGAGGTGATGGAAGGAAA Chr3:104620855..104620875 60.04 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGAGGTGATGGAAGGAAA Chr3:104620855..104620875 60.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GATACCTTGTTGAGCTGGCTTT Chr3:104621018..104621040 59.79 45.46 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GATACCTTGTTGAGCTGGCTTT Chr3:104621018..104621040 59.79 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002227