Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13519
Trapped Gene
AL807784.11-206 (ENSMUSG00000084142)
Vector Insertion
Chr X: 99373611 - 99373669
Public Clones CMHD-GT_302H12-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000708411 (ChrX:99373670..99373996 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGTCAAGTACGACCGCAAG ChrX:99373820..99373839 60.31 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000708411 (ChrX:99373670..99373996 -)
Downstram Exon
ENSMUSE00000718286 (ChrX:99373533..99373610 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGTCAAGTACGACCGCAAG ChrX:99373820..99373839 60.31 55 CACTTCTTCTGGGGTGTGCT ChrX:99373512..99373531 60.3 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000708411 ChrX:99373670..99373996 AGGTCAAGTACGACCGCAAG ChrX:99373820..99373839 60.31 55

*** Putative Vector Insertion (Chr X: 99373611 - 99373669) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000718286 ChrX:99373533..99373610 CACTTCTTCTGGGGTGTGCT ChrX:99373512..99373531 60.3 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATGGATCCTGGCCTCTCTA ChrX:99373619..99373639 60.17 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATGGATCCTGGCCTCTCTA ChrX:99373619..99373639 60.17 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000084142