Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13524
Trapped Gene
Gtf2h1 (ENSMUSG00000006599)
Vector Insertion
Chr 7: 54052836 - 54057041
Public Clones D037G10 (ggtc) E115A06 (ggtc) D136D05 (ggtc) CMHD-GT_301D12-3 (cmhd) IST15051G1 (tigm)
IST14529A8 (tigm) IST14155G10 (tigm)
Private Clones OST455206 (lexicon) OST442501 (lexicon) OST389533 (lexicon) OST382464 (lexicon)
OST378643 (lexicon) OST377580 (lexicon) OST367379 (lexicon) OST357041 (lexicon)
OST333927 (lexicon) OST333054 (lexicon) OST331507 (lexicon) OST326792 (lexicon)
OST326321 (lexicon) OST291551 (lexicon) OST286157 (lexicon) OST278114 (lexicon)
OST266183 (lexicon) OST263224 (lexicon) OST234964 (lexicon) OST204357 (lexicon)
OST175052 (lexicon) OST171672 (lexicon) OST148612 (lexicon) OST141481 (lexicon)
OST115742 (lexicon) OST38040 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000674034 (Chr7:54052767..54052835 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000674034 (Chr7:54052767..54052835 +)
Downstram Exon
ENSMUSE00000674032 (Chr7:54057042..54057210 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000204270 Chr7:54051473..54051658 No primer for this exon
upstream ENSMUSE00000674036 Chr7:54052041..54052133 No primer for this exon
upstream ENSMUSE00000674034 Chr7:54052767..54052835 No primer for this exon

*** Putative Vector Insertion (Chr 7: 54052836 - 54057041) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000204275 Chr7:54057042..54057210 No primer for this exon
downstream ENSMUSE00000674032 Chr7:54057042..54057210 No primer for this exon
downstream ENSMUSE00000204279 Chr7:54059187..54059379 No primer for this exon
downstream ENSMUSE00000204277 Chr7:54060331..54060493 No primer for this exon
downstream ENSMUSE00000204287 Chr7:54062106..54062199 No primer for this exon
downstream ENSMUSE00000330825 Chr7:54063907..54064056 No primer for this exon
downstream ENSMUSE00000330818 Chr7:54064170..54064249 No primer for this exon
downstream ENSMUSE00000204278 Chr7:54067802..54067929 No primer for this exon
downstream ENSMUSE00000204280 Chr7:54068032..54068119 No primer for this exon
downstream ENSMUSE00000204283 Chr7:54069486..54069574 No primer for this exon
downstream ENSMUSE00000204285 Chr7:54070670..54070787 No primer for this exon
downstream ENSMUSE00000204281 Chr7:54071754..54071844 No primer for this exon
downstream ENSMUSE00000204276 Chr7:54072267..54072382 No primer for this exon
downstream ENSMUSE00000204290 Chr7:54074492..54074584 No primer for this exon
downstream ENSMUSE00000204272 Chr7:54078193..54079167 No primer for this exon
downstream ENSMUSE00000674025 Chr7:54078193..54078645 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACACAAAACAGCAGCTTACCT Chr7:54055788..54055810 59.49 45.46 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACACAAAACAGCAGCTTACCT Chr7:54055788..54055810 59.49 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006599