Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13525
Trapped Gene
2700094K13Rik (ENSMUSG00000076437)
Vector Insertion
Chr 2: 84509381 - 84509555
Public Clones CMHD-GT_301C6-3 (cmhd) CMHD-GT_446E7-3 (cmhd)
Private Clones OST255308 (lexicon) OST189316 (lexicon) OST158892 (lexicon) OST134281 (lexicon)
OST59132 (lexicon) OST45239 (lexicon) OST43448 (lexicon) OST42898 (lexicon)
OST42597 (lexicon) OST35522 (lexicon) OST10966 (lexicon) OST8550 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662180 (Chr2:84509382..84509554 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCATTTATGATGGTGCATGG Chr2:84509511..84509530 59.78 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662180 (Chr2:84509382..84509554 -)
Downstram Exon
ENSMUSE00000721448 (Chr2:84509375..84509554 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCATTTATGATGGTGCATGG Chr2:84509511..84509530 59.78 45 TGCCTCACAACTGAACCATC Chr2:84509419..84509438 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662179 Chr2:84510640..84510852 CCTATGGAGACGGTGGACAA Chr2:84510685..84510704 60.91 55
upstream ENSMUSE00000662183 Chr2:84510640..84510865 CCTATGGAGACGGTGGACAA Chr2:84510685..84510704 60.91 55
upstream ENSMUSE00000708438 Chr2:84510640..84510865 CCTATGGAGACGGTGGACAA Chr2:84510685..84510704 60.91 55
upstream ENSMUSE00000662182 Chr2:84510402..84510547 GCTACCTGTGCAAGTGAACC Chr2:84510459..84510478 58.37 55
upstream ENSMUSE00000718550 Chr2:84510169..84510273 CCACGAAAGCTCAAATTTCC Chr2:84510219..84510238 59.69 45
upstream ENSMUSE00000662181 Chr2:84510144..84510273 CCACGAAAGCTCAAATTTCC Chr2:84510219..84510238 59.69 45
upstream ENSMUSE00000662178 Chr2:84509981..84510273 CAGGGAACGTCTCCTTACCA Chr2:84510087..84510106 60.1 55
upstream ENSMUSE00000662180 Chr2:84509382..84509554 GCATTTATGATGGTGCATGG Chr2:84509511..84509530 59.78 45

*** Putative Vector Insertion (Chr 2: 84509381 - 84509555) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000721448 Chr2:84509375..84509554 TGCCTCACAACTGAACCATC Chr2:84509419..84509438 59.68 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr2:84509487..84509507 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGTCCTTGTGATGGAACC Chr2:84509583..84509603 60.36 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000076437