Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13526
Trapped Gene
Nfyc (ENSMUSG00000032897)
Vector Insertion
Chr 4: 120462981 - 120463095
Public Clones CMHD-GT_301C5-3 (cmhd)
Private Clones OST469527 (lexicon) OST467002 (lexicon) OST463857 (lexicon) OST458947 (lexicon)
OST458405 (lexicon) OST457398 (lexicon) OST454945 (lexicon) OST454656 (lexicon)
OST449360 (lexicon) OST443785 (lexicon) OST435112 (lexicon) OST433063 (lexicon)
OST432111 (lexicon) OST429550 (lexicon) OST425046 (lexicon) OST420916 (lexicon)
OST419883 (lexicon) OST414065 (lexicon) OST402338 (lexicon) OST397349 (lexicon)
OST392777 (lexicon) OST385650 (lexicon) OST383532 (lexicon) OST382957 (lexicon)
OST381905 (lexicon) OST374188 (lexicon) OST374113 (lexicon) OST372184 (lexicon)
OST369256 (lexicon) OST368017 (lexicon) OST359838 (lexicon) OST358166 (lexicon)
OST358077 (lexicon) OST337542 (lexicon) OST337103 (lexicon) OST331434 (lexicon)
OST329506 (lexicon) OST329230 (lexicon) OST321376 (lexicon) OST314353 (lexicon)
OST309716 (lexicon) OST307892 (lexicon) OST303851 (lexicon) OST303415 (lexicon)
OST303208 (lexicon) OST303055 (lexicon) OST301615 (lexicon) OST297754 (lexicon)
OST291748 (lexicon) OST288819 (lexicon) OST288406 (lexicon) OST284809 (lexicon)
OST281269 (lexicon) OST280692 (lexicon) OST279571 (lexicon) OST277068 (lexicon)
OST271066 (lexicon) OST267798 (lexicon) OST259119 (lexicon) OST258551 (lexicon)
OST257913 (lexicon) OST255985 (lexicon) OST253146 (lexicon) OST252243 (lexicon)
OST251609 (lexicon) OST251090 (lexicon) OST243696 (lexicon) OST243023 (lexicon)
OST239992 (lexicon) OST238784 (lexicon) OST238041 (lexicon) OST236139 (lexicon)
OST235364 (lexicon) OST233088 (lexicon) OST232148 (lexicon) OST230426 (lexicon)
OST225932 (lexicon) OST222495 (lexicon) OST216178 (lexicon) OST211720 (lexicon)
OST211177 (lexicon) OST210699 (lexicon) OST210677 (lexicon) OST206135 (lexicon)
OST206022 (lexicon) OST205599 (lexicon) OST203937 (lexicon) OST202455 (lexicon)
OST201868 (lexicon) OST199572 (lexicon) OST197959 (lexicon) OST192937 (lexicon)
OST187923 (lexicon) OST185480 (lexicon) OST184462 (lexicon) OST184366 (lexicon)
OST178894 (lexicon) OST177171 (lexicon) OST174622 (lexicon) OST173673 (lexicon)
OST172976 (lexicon) OST168015 (lexicon) OST167135 (lexicon) OST154171 (lexicon)
OST151164 (lexicon) OST149488 (lexicon) OST148908 (lexicon) OST148795 (lexicon)
OST144813 (lexicon) OST142284 (lexicon) OST139051 (lexicon) OST136010 (lexicon)
OST135507 (lexicon) OST135371 (lexicon) OST134397 (lexicon) OST131231 (lexicon)
OST129853 (lexicon) OST124978 (lexicon) OST123609 (lexicon) OST123168 (lexicon)
OST104725 (lexicon) OST104329 (lexicon) OST81603 (lexicon) OST79564 (lexicon)
OST67667 (lexicon) OST65246 (lexicon) OST65124 (lexicon) OST63591 (lexicon)
OST63208 (lexicon) OST60905 (lexicon) OST57426 (lexicon) OST57197 (lexicon)
OST57144 (lexicon) OST56989 (lexicon) OST56293 (lexicon) OST54832 (lexicon)
OST54246 (lexicon) OST49025 (lexicon) OST44611 (lexicon) OST43432 (lexicon)
OST39584 (lexicon) OST36664 (lexicon) OST36660 (lexicon) OST33519 (lexicon)
OST32919 (lexicon) OST32077 (lexicon) OST30161 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000708947 (Chr4:120462982..120463094 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAAGCCTCCAGTCCTTCTG Chr4:120463019..120463038 59.98 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000708947 (Chr4:120462982..120463094 -)
Downstram Exon
ENSMUSE00000412384 (Chr4:120462982..120463094 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAAGCCTCCAGTCCTTCTG Chr4:120463019..120463038 59.98 55 GAAGGACTGGAGGCTTTGCT Chr4:120462999..120463018 60.9 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000708701 Chr4:120504046..120504177 ACAGTTACCCGTTGCTGGTT Chr4:120504062..120504081 59.52 50
upstream ENSMUSE00000631361 Chr4:120498135..120498301 No primer for this exon
upstream ENSMUSE00000711667 Chr4:120488067..120488317 ACAGCTGTTCGGGTTTTCAC Chr4:120488214..120488233 60.16 50
upstream ENSMUSE00000412384 Chr4:120462982..120463094 CAAAGCCTCCAGTCCTTCTG Chr4:120463019..120463038 59.98 55
upstream ENSMUSE00000708947 Chr4:120462982..120463094 CAAAGCCTCCAGTCCTTCTG Chr4:120463019..120463038 59.98 55

*** Putative Vector Insertion (Chr 4: 120462981 - 120463095) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000372119 Chr4:120454077..120454148 AATACGAGCCAGTGGGAGTT Chr4:120454088..120454107 58.67 50
downstream ENSMUSE00000714266 Chr4:120451725..120451838 CAGGCTCGAAGAGTCAGCTC Chr4:120451740..120451759 60.43 60
downstream ENSMUSE00000718222 Chr4:120451725..120451838 CAGGCTCGAAGAGTCAGCTC Chr4:120451740..120451759 60.43 60
downstream ENSMUSE00000243383 Chr4:120446277..120446372 GCCATGGCAATATCATTCCT Chr4:120446331..120446350 59.75 45
downstream ENSMUSE00000669326 Chr4:120446277..120446372 GCCATGGCAATATCATTCCT Chr4:120446331..120446350 59.75 45
downstream ENSMUSE00000243374 Chr4:120441331..120441504 CACAGACTGGCGTACCTCCT Chr4:120441462..120441481 60.32 60
downstream ENSMUSE00000669325 Chr4:120441331..120441504 CACAGACTGGCGTACCTCCT Chr4:120441462..120441481 60.32 60
downstream ENSMUSE00000669324 Chr4:120437819..120437977 GGCCTGTACAATCTGCACCT Chr4:120437899..120437918 60.14 55
downstream ENSMUSE00000716802 Chr4:120437819..120437977 GGCCTGTACAATCTGCACCT Chr4:120437899..120437918 60.14 55
downstream ENSMUSE00000719780 Chr4:120437819..120437977 GGCCTGTACAATCTGCACCT Chr4:120437899..120437918 60.14 55
downstream ENSMUSE00000243355 Chr4:120434233..120434340 CAACTTGGGTGCCTGATACA Chr4:120434252..120434271 59.57 50
downstream ENSMUSE00000669332 Chr4:120434233..120434340 CAACTTGGGTGCCTGATACA Chr4:120434252..120434271 59.57 50
downstream ENSMUSE00000243349 Chr4:120431937..120431996 GTCCTTGCTGGACCTCTGTC Chr4:120431947..120431966 59.84 60
downstream ENSMUSE00000599794 Chr4:120431937..120431996 GTCCTTGCTGGACCTCTGTC Chr4:120431947..120431966 59.84 60
downstream ENSMUSE00000460378 Chr4:120430484..120430901 CTGGGGCTCTATGGCAAATA Chr4:120430703..120430722 60.05 50
downstream ENSMUSE00000631360 Chr4:120430484..120430901 CTGGGGCTCTATGGCAAATA Chr4:120430703..120430722 60.05 50
downstream ENSMUSE00000719127 Chr4:120430043..120430901 CTGGGGCTCTATGGCAAATA Chr4:120430703..120430722 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCAGTGATAATCGCCTTGC Chr4:120463032..120463052 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGACGTGACTGGGAAAACC Chr4:120463028..120463048 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032897